Incidental Mutation 'R1121:Rem1'
ID95594
Institutional Source Beutler Lab
Gene Symbol Rem1
Ensembl Gene ENSMUSG00000000359
Gene Namerad and gem related GTP binding protein 1
SynonymsE030011C07Rik
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1121 (G1)
Quality Score142
Status Not validated
Chromosome2
Chromosomal Location152626951-152635198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152634535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 238 (V238M)
Ref Sequence ENSEMBL: ENSMUSP00000000369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000369]
Predicted Effect probably damaging
Transcript: ENSMUST00000000369
AA Change: V238M

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000369
Gene: ENSMUSG00000000359
AA Change: V238M

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:Roc 82 198 1e-10 PFAM
Pfam:Ras 82 244 2.6e-32 PFAM
low complexity region 258 290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139370
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase and member of the RAS-like GTP-binding protein family. The encoded protein is expressed in endothelial cells, where it promotes reorganization of the actin cytoskeleton and morphological changes in the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Rem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1122:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1126:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1233:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1235:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1378:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1709:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1713:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1911:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1912:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R5442:Rem1 UTSW 2 152628057 critical splice acceptor site probably null
R5853:Rem1 UTSW 2 152628280 missense possibly damaging 0.92
R6062:Rem1 UTSW 2 152628097 start codon destroyed probably null 1.00
R6072:Rem1 UTSW 2 152634517 missense probably benign
R7215:Rem1 UTSW 2 152628149 missense probably damaging 1.00
R7635:Rem1 UTSW 2 152634665 missense probably damaging 1.00
X0057:Rem1 UTSW 2 152629191 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTTCCTGAGAGTTTGAACACA -3'
(R):5'- CTTTTCTCCTCAGTGGCACCATA -3'

Sequencing Primer
(F):5'- CATCTCTTCCCACCTTTATC -3'
(R):5'- ATAGTGTCCCATCACCCCAG -3'
Posted On2014-01-05