Incidental Mutation 'R1121:Xkr7'
ID95595
Institutional Source Beutler Lab
Gene Symbol Xkr7
Ensembl Gene ENSMUSG00000042631
Gene NameX-linked Kx blood group related 7
Synonyms
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1121 (G1)
Quality Score127
Status Not validated
Chromosome2
Chromosomal Location153031852-153055775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153054423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 399 (T399I)
Ref Sequence ENSEMBL: ENSMUSP00000049346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037235]
Predicted Effect probably damaging
Transcript: ENSMUST00000037235
AA Change: T399I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049346
Gene: ENSMUSG00000042631
AA Change: T399I

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 170 193 N/A INTRINSIC
IQ 196 218 1.28e1 SMART
low complexity region 260 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Other mutations in Xkr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02715:Xkr7 APN 2 153054357 missense probably damaging 0.99
R0125:Xkr7 UTSW 2 153032426 missense probably benign 0.01
R0531:Xkr7 UTSW 2 153032352 missense possibly damaging 0.65
R2092:Xkr7 UTSW 2 153054063 missense probably damaging 0.98
R2132:Xkr7 UTSW 2 153052896 missense probably benign
R2264:Xkr7 UTSW 2 153054257 missense probably damaging 1.00
R2337:Xkr7 UTSW 2 153054398 missense possibly damaging 0.94
R2341:Xkr7 UTSW 2 153054398 missense possibly damaging 0.94
R4270:Xkr7 UTSW 2 153054315 missense possibly damaging 0.80
R4513:Xkr7 UTSW 2 153054633 missense probably benign 0.39
R4880:Xkr7 UTSW 2 153054953 missense probably damaging 1.00
R5022:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5023:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5057:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5198:Xkr7 UTSW 2 153054953 missense probably damaging 1.00
R5433:Xkr7 UTSW 2 153054324 missense probably damaging 1.00
R7385:Xkr7 UTSW 2 153054063 nonsense probably null
R7940:Xkr7 UTSW 2 153032215 missense probably damaging 1.00
R8334:Xkr7 UTSW 2 153054963 missense probably damaging 1.00
X0061:Xkr7 UTSW 2 153054183 missense probably benign 0.44
Z1177:Xkr7 UTSW 2 153054497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGTGCTGTTGTCCAAGTG -3'
(R):5'- AGAGACCTTGGCGGACTTGTGATG -3'

Sequencing Primer
(F):5'- AGTGTCTACAAGCTCTACTTTGG -3'
(R):5'- GACTTGTGATGGCATCAGC -3'
Posted On2014-01-05