Incidental Mutation 'R1121:Fam214b'
ID95602
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43034947 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 317 (K317E)
Ref Sequence ENSEMBL: ENSMUSP00000103593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000135067] [ENSMUST00000152846] [ENSMUST00000144999] [ENSMUST00000136326] [ENSMUST00000138030]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036462
AA Change: K317E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: K317E

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107956
AA Change: K317E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: K317E

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107957
AA Change: K317E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: K317E

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107958
AA Change: K317E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: K317E

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107959
AA Change: K317E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: K317E

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect probably benign
Transcript: ENSMUST00000135067
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143371
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135660
SMART Domains Protein: ENSMUSP00000123478
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 2 153 4.16e-39 SMART
coiled coil region 189 210 N/A INTRINSIC
Pfam:Band_7_C 218 280 3.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
BB010:Fam214b UTSW 4 43035919 missense probably benign
BB020:Fam214b UTSW 4 43035919 missense probably benign
PIT4431001:Fam214b UTSW 4 43036024 missense probably damaging 0.99
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R2853:Fam214b UTSW 4 43036293 missense probably benign
R3878:Fam214b UTSW 4 43035867 missense probably damaging 1.00
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R6556:Fam214b UTSW 4 43033896 missense probably damaging 0.96
R7107:Fam214b UTSW 4 43036434 missense probably benign 0.10
R7608:Fam214b UTSW 4 43036533 missense probably damaging 0.99
R7933:Fam214b UTSW 4 43035919 missense probably benign
R7982:Fam214b UTSW 4 43034483 missense probably damaging 1.00
R8017:Fam214b UTSW 4 43034413 missense probably damaging 1.00
R8328:Fam214b UTSW 4 43034751 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGTTGGCTTGAGTATCCTGAG -3'
(R):5'- TGTAGATTGAACCCAAGGCTGTGTG -3'

Sequencing Primer
(F):5'- AGTATTCCTGTTCCCAGTCCTTG -3'
(R):5'- gtctcaaatagccttcaaactctc -3'
Posted On2014-01-05