Incidental Mutation 'R1121:Gm7534'
ID95612
Institutional Source Beutler Lab
Gene Symbol Gm7534
Ensembl Gene ENSMUSG00000073747
Gene Namepredicted gene 7534
Synonyms
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134190804-134203004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134202937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
Predicted Effect probably benign
Transcript: ENSMUST00000097849
AA Change: D19G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: D19G

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122228
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Gm7534
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Gm7534 APN 4 134201980 missense probably benign 0.27
IGL03170:Gm7534 APN 4 134193034 missense possibly damaging 0.57
FR4342:Gm7534 UTSW 4 134202631 small insertion probably benign
FR4976:Gm7534 UTSW 4 134202630 small insertion probably benign
R0487:Gm7534 UTSW 4 134202778 missense probably damaging 0.97
R0530:Gm7534 UTSW 4 134202910 missense probably benign
R0553:Gm7534 UTSW 4 134202518 missense possibly damaging 0.85
R1458:Gm7534 UTSW 4 134196833 missense probably benign 0.01
R1748:Gm7534 UTSW 4 134200299 missense probably damaging 1.00
R1748:Gm7534 UTSW 4 134202119 missense possibly damaging 0.57
R1913:Gm7534 UTSW 4 134192675 critical splice donor site probably null
R2029:Gm7534 UTSW 4 134202358 missense possibly damaging 0.87
R2069:Gm7534 UTSW 4 134201941 missense possibly damaging 0.63
R2237:Gm7534 UTSW 4 134202205 missense unknown
R2239:Gm7534 UTSW 4 134202205 missense unknown
R3943:Gm7534 UTSW 4 134200345 missense probably benign 0.15
R4646:Gm7534 UTSW 4 134202148 missense probably benign 0.00
R4673:Gm7534 UTSW 4 134200347 missense probably benign 0.01
R4838:Gm7534 UTSW 4 134193099 missense probably benign 0.04
R5002:Gm7534 UTSW 4 134196920 missense probably benign 0.09
R5593:Gm7534 UTSW 4 134193039 missense probably damaging 0.99
R5606:Gm7534 UTSW 4 134200212 missense probably benign 0.13
R6553:Gm7534 UTSW 4 134202056 missense probably damaging 0.99
R6834:Gm7534 UTSW 4 134193165 missense possibly damaging 0.95
R6931:Gm7534 UTSW 4 134193153 missense probably benign 0.28
R7526:Gm7534 UTSW 4 134200073 splice site probably null
R7771:Gm7534 UTSW 4 134195443 missense probably benign 0.01
R8271:Gm7534 UTSW 4 134202967 missense unknown
RF015:Gm7534 UTSW 4 134193027 missense probably benign
T0975:Gm7534 UTSW 4 134202629 small insertion probably benign
Z1176:Gm7534 UTSW 4 134200338 missense possibly damaging 0.90
Z1176:Gm7534 UTSW 4 134202677 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTGCCAGGTGACATACTCATTG -3'
(R):5'- AGCACAGACGGACTTAAGCGAC -3'

Sequencing Primer
(F):5'- CCTGAGTCTCAGATGTGGC -3'
(R):5'- TTAAGCGACAGCAGGACTAAACTC -3'
Posted On2014-01-05