Incidental Mutation 'R1121:Vmn1r26'
ID95618
Institutional Source Beutler Lab
Gene Symbol Vmn1r26
Ensembl Gene ENSMUSG00000048697
Gene Namevomeronasal 1 receptor 26
SynonymsV1rc17
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location58004934-58015159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58008662 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 181 (T181A)
Ref Sequence ENSEMBL: ENSMUSP00000154463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049694] [ENSMUST00000228040] [ENSMUST00000228070] [ENSMUST00000228951]
Predicted Effect probably benign
Transcript: ENSMUST00000049694
AA Change: T181A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052301
Gene: ENSMUSG00000048697
AA Change: T181A

DomainStartEndE-ValueType
Pfam:V1R 28 293 5.8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228040
AA Change: T181A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228070
AA Change: T181A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228951
AA Change: T181A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Vmn1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Vmn1r26 APN 6 58009142 missense possibly damaging 0.81
IGL02609:Vmn1r26 APN 6 58008875 missense probably damaging 1.00
R1881:Vmn1r26 UTSW 6 58008665 missense probably benign 0.20
R1958:Vmn1r26 UTSW 6 58008301 missense probably benign 0.01
R1978:Vmn1r26 UTSW 6 58009126 missense possibly damaging 0.83
R2106:Vmn1r26 UTSW 6 58008725 missense possibly damaging 0.69
R2117:Vmn1r26 UTSW 6 58008350 missense possibly damaging 0.65
R2323:Vmn1r26 UTSW 6 58008857 missense probably damaging 1.00
R4917:Vmn1r26 UTSW 6 58008823 missense probably damaging 0.99
R5695:Vmn1r26 UTSW 6 58008753 missense probably damaging 1.00
R6355:Vmn1r26 UTSW 6 58008551 missense probably benign 0.02
R6948:Vmn1r26 UTSW 6 58008733 missense probably damaging 0.98
R7114:Vmn1r26 UTSW 6 58008770 missense probably benign 0.02
R7977:Vmn1r26 UTSW 6 58008279 nonsense probably null
R7987:Vmn1r26 UTSW 6 58008279 nonsense probably null
R8311:Vmn1r26 UTSW 6 58008533 missense probably benign 0.39
R8442:Vmn1r26 UTSW 6 58008743 missense possibly damaging 0.95
RF020:Vmn1r26 UTSW 6 58008720 missense probably benign 0.35
Z1176:Vmn1r26 UTSW 6 58008597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCACAACAGGACTGAGGTAG -3'
(R):5'- AGTGTGTTCCAGGCCGTCACTATG -3'

Sequencing Primer
(F):5'- GATGAGGTCTACCCAGTACATTAC -3'
(R):5'- GTCACTATGAGTCCCAGTACC -3'
Posted On2014-01-05