Incidental Mutation 'R1121:Cops7a'
ID95626
Institutional Source Beutler Lab
Gene Symbol Cops7a
Ensembl Gene ENSMUSG00000030127
Gene NameCOP9 signalosome subunit 7A
SynonymsCOP9 complex S7a, D6Ertd35e
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124958413-124965538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124962416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000108058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032220] [ENSMUST00000112439] [ENSMUST00000129446] [ENSMUST00000129976] [ENSMUST00000148485]
Predicted Effect probably benign
Transcript: ENSMUST00000032220
AA Change: D90G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032220
Gene: ENSMUSG00000030127
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083831
Predicted Effect probably benign
Transcript: ENSMUST00000112439
AA Change: D90G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108058
Gene: ENSMUSG00000030127
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129446
AA Change: D90G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114420
Gene: ENSMUSG00000030127
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 176 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129976
AA Change: D90G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117584
Gene: ENSMUSG00000030127
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PINT 87 177 2.65e-18 SMART
coiled coil region 197 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135645
Predicted Effect probably benign
Transcript: ENSMUST00000148485
SMART Domains Protein: ENSMUSP00000115348
Gene: ENSMUSG00000030127

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Blast:PINT 31 77 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149346
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Cops7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cops7a APN 6 124962416 missense probably benign 0.00
rubric UTSW 6 124960176 missense probably damaging 1.00
H8562:Cops7a UTSW 6 124962453 unclassified probably benign
R0139:Cops7a UTSW 6 124961360 missense probably damaging 0.98
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R0242:Cops7a UTSW 6 124964854 missense probably benign 0.00
R1662:Cops7a UTSW 6 124962438 missense probably damaging 0.96
R1935:Cops7a UTSW 6 124962396 nonsense probably null
R2920:Cops7a UTSW 6 124962362 missense probably benign 0.21
R3796:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3797:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3799:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R3854:Cops7a UTSW 6 124959832 missense probably damaging 1.00
R5034:Cops7a UTSW 6 124962620 splice site probably null
R5858:Cops7a UTSW 6 124960171 missense possibly damaging 0.82
R6477:Cops7a UTSW 6 124960176 missense probably damaging 1.00
R6879:Cops7a UTSW 6 124958785 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTTCAGTTCAGACCCAGACAGG -3'
(R):5'- AGAAAGCGACTTTGCCTCCACC -3'

Sequencing Primer
(F):5'- ACCCAGACAGGGGAGGC -3'
(R):5'- TATGGGACCTATGCGGACTAC -3'
Posted On2014-01-05