Incidental Mutation 'R1005:Klk1b8'
ID95629
Institutional Source Beutler Lab
Gene Symbol Klk1b8
Ensembl Gene ENSMUSG00000063089
Gene Namekallikrein 1-related peptidase b8
SynonymsmGK-8, Klk8, TADG14
MMRRC Submission 039115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1005 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43950664-43954941 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 43954334 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 198 (C198*)
Ref Sequence ENSEMBL: ENSMUSP00000072063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072204]
Predicted Effect probably null
Transcript: ENSMUST00000072204
AA Change: C198*
SMART Domains Protein: ENSMUSP00000072063
Gene: ENSMUSG00000063089
AA Change: C198*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.03e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,665,514 D163G probably benign Het
Adck1 G A 12: 88,402,102 V117M probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa6 A T 11: 55,001,218 M304K possibly damaging Het
Aox1 A G 1: 58,065,352 T563A probably benign Het
AW551984 G A 9: 39,593,733 Q488* probably null Het
Cbx2 A G 11: 119,028,574 R322G probably benign Het
Csmd1 T A 8: 16,288,693 T467S probably damaging Het
Cspg4 A G 9: 56,888,736 I1252V probably benign Het
Enah A T 1: 181,961,930 probably benign Het
Fam171a2 T C 11: 102,440,181 M185V probably benign Het
Flt1 G T 5: 147,681,885 N213K probably damaging Het
Fpr-rs3 T C 17: 20,624,084 N265S probably benign Het
Gbp2 T C 3: 142,630,501 probably benign Het
Gm6871 A T 7: 41,546,258 C352S probably damaging Het
Gm9742 T C 13: 8,035,215 noncoding transcript Het
Iars T C 13: 49,687,445 I18T possibly damaging Het
Kel T C 6: 41,688,617 Y523C probably damaging Het
Mc3r A G 2: 172,249,563 H235R probably benign Het
Nr0b2 G T 4: 133,553,474 R17L probably benign Het
Olfr43 A G 11: 74,207,136 F27L probably benign Het
Prl7a1 G A 13: 27,642,446 P2L possibly damaging Het
Prrt3 G A 6: 113,494,778 A811V probably damaging Het
Rab28 A G 5: 41,698,383 probably benign Het
Rhobtb2 A G 14: 69,798,277 L115P probably damaging Het
Robo4 A G 9: 37,408,251 E599G probably damaging Het
Ros1 T A 10: 52,128,405 probably benign Het
Slc22a27 A T 19: 7,926,751 L7Q probably damaging Het
Slfn5 T A 11: 82,960,158 L427H probably damaging Het
Smarcad1 C T 6: 65,108,727 H890Y probably benign Het
Snx31 A G 15: 36,517,691 probably benign Het
Sptb C T 12: 76,601,859 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ston2 T C 12: 91,648,848 D262G possibly damaging Het
Trank1 T G 9: 111,333,721 M16R probably benign Het
Trrap A G 5: 144,805,727 E1385G probably damaging Het
Ttc8 T C 12: 98,937,144 S47P probably benign Het
Other mutations in Klk1b8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Klk1b8 APN 7 43954786 missense probably benign 0.40
IGL01076:Klk1b8 APN 7 43954855 missense probably damaging 1.00
IGL01685:Klk1b8 APN 7 43954870 missense possibly damaging 0.88
IGL01771:Klk1b8 APN 7 43954866 missense probably damaging 0.99
IGL02272:Klk1b8 APN 7 43952793 missense probably damaging 1.00
IGL02596:Klk1b8 APN 7 43952763 missense probably damaging 1.00
R0789:Klk1b8 UTSW 7 43945727 unclassified probably benign
R1628:Klk1b8 UTSW 7 43954141 splice site probably null
R1688:Klk1b8 UTSW 7 43945805 unclassified probably benign
R1954:Klk1b8 UTSW 7 43953848 splice site probably benign
R4344:Klk1b8 UTSW 7 43945762 unclassified probably benign
R6294:Klk1b8 UTSW 7 43952772 missense probably damaging 1.00
R6941:Klk1b8 UTSW 7 43952789 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCAAGGAACAATGCTGGGTGTG -3'
(R):5'- GTGGTGGATTTGACAGTCCCCTAAG -3'

Sequencing Primer
(F):5'- CAATGCTGGGTGTGGAGGAG -3'
(R):5'- TTTGACAGTCCCCTAAGACAAATC -3'
Posted On2014-01-05