Incidental Mutation 'R1121:Grin2d'
ID95630
Institutional Source Beutler Lab
Gene Symbol Grin2d
Ensembl Gene ENSMUSG00000002771
Gene Nameglutamate receptor, ionotropic, NMDA2D (epsilon 4)
SynonymsNR2D, GluRepsilon4, NMDAR2D, GluN2D
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45831883-45878378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45854347 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 655 (M655L)
Ref Sequence ENSEMBL: ENSMUSP00000147663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000211713]
Predicted Effect probably damaging
Transcript: ENSMUST00000002848
AA Change: M655L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: M655L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211713
AA Change: M655L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Grin2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Grin2d APN 7 45853292 missense probably damaging 0.99
IGL01772:Grin2d APN 7 45858466 missense probably benign 0.00
IGL01952:Grin2d APN 7 45862280 missense probably benign 0.23
IGL01994:Grin2d APN 7 45857972 missense probably damaging 1.00
IGL02161:Grin2d APN 7 45854422 missense possibly damaging 0.82
IGL03180:Grin2d APN 7 45853329 missense probably damaging 1.00
R1934:Grin2d UTSW 7 45856827 missense probably damaging 1.00
R2915:Grin2d UTSW 7 45833357 unclassified probably benign
R4162:Grin2d UTSW 7 45857618 missense probably damaging 0.98
R4753:Grin2d UTSW 7 45833906 missense probably damaging 0.98
R4781:Grin2d UTSW 7 45862481 missense probably damaging 1.00
R4785:Grin2d UTSW 7 45856781 missense probably damaging 0.96
R4820:Grin2d UTSW 7 45857939 missense probably damaging 1.00
R4877:Grin2d UTSW 7 45854615 missense probably damaging 1.00
R4979:Grin2d UTSW 7 45857933 missense probably benign 0.03
R5092:Grin2d UTSW 7 45854268 missense probably damaging 1.00
R6364:Grin2d UTSW 7 45858454 missense possibly damaging 0.54
R6565:Grin2d UTSW 7 45834755 missense probably damaging 1.00
R6747:Grin2d UTSW 7 45862268 missense probably damaging 0.99
R6816:Grin2d UTSW 7 45833682 unclassified probably benign
R7072:Grin2d UTSW 7 45857498 missense probably damaging 1.00
R7237:Grin2d UTSW 7 45866176 nonsense probably null
R7243:Grin2d UTSW 7 45866128 missense probably damaging 1.00
R7385:Grin2d UTSW 7 45857536 missense probably damaging 1.00
R7577:Grin2d UTSW 7 45862379 missense probably benign 0.01
R8100:Grin2d UTSW 7 45833747 missense unknown
R8179:Grin2d UTSW 7 45858028 nonsense probably null
Z1177:Grin2d UTSW 7 45833177 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTTACAAGCCAGCTCAGCCTGC -3'
(R):5'- GATGATGTTCGTCATGTGCCTCACC -3'

Sequencing Primer
(F):5'- TGCCCCCTGTACACACC -3'
(R):5'- CTGTGGGCTATAACCGAAGC -3'
Posted On2014-01-05