Mutagenetix > Incidental Mutation

Incidental Mutation 'R1121:Ap3b2'

95632

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

Naptb, beta3B

MMRRC Submission

039194-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R1121 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81110147-81143673 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81113943 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 815 (T815S)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090]

AlphaFold

Q9JME5

Predicted Effect

unknown
Transcript: ENSMUST00000082090
AA Change: T815S

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: T815S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147624

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l1	A	T	6: 90,566,366 (GRCm39)	I646L	probably benign	Het
Ankar	G	A	1: 72,690,822 (GRCm39)		probably null	Het
Atosb	T	C	4: 43,034,947 (GRCm39)	K317E	probably damaging	Het
Cops7a	T	C	6: 124,939,379 (GRCm39)	D90G	probably benign	Het
Dpysl2	C	T	14: 67,100,001 (GRCm39)	M78I	probably benign	Het
Erc2	T	C	14: 28,197,612 (GRCm39)		probably benign	Het
Fam120a	A	T	13: 49,063,913 (GRCm39)		probably null	Het
Fam98a	C	A	17: 75,845,529 (GRCm39)	G406C	unknown	Het
G6pc3	G	A	11: 102,080,768 (GRCm39)	S6N	possibly damaging	Het
Grin2d	T	G	7: 45,503,771 (GRCm39)	M655L	probably damaging	Het
Hnrnpul1	G	T	7: 25,440,332 (GRCm39)	T308K	possibly damaging	Het
Ipp	T	A	4: 116,377,872 (GRCm39)	N247K	probably benign	Het
Islr	T	C	9: 58,065,045 (GRCm39)	N154S	probably benign	Het
Itk	A	G	11: 46,222,721 (GRCm39)	Y577H	possibly damaging	Het
Micu1	C	T	10: 59,624,804 (GRCm39)	T282I	possibly damaging	Het
Or6d14	T	G	6: 116,534,190 (GRCm39)	V268G	probably damaging	Het
Pcdhb14	T	A	18: 37,582,645 (GRCm39)	Y584N	probably damaging	Het
Pnlip	A	G	19: 58,669,340 (GRCm39)		probably null	Het
Ppip5k2	A	T	1: 97,684,585 (GRCm39)	Y129N	probably damaging	Het
Prtg	T	G	9: 72,813,449 (GRCm39)	H936Q	probably benign	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Spef1l	T	A	7: 139,556,543 (GRCm39)	D148V	probably benign	Het
Sptbn5	T	A	2: 119,899,871 (GRCm39)		probably null	Het
Thnsl1	A	G	2: 21,216,975 (GRCm39)	D243G	probably benign	Het
Ugt2a3	A	T	5: 87,475,548 (GRCm39)	D361E	probably damaging	Het
Uhrf1	T	A	17: 56,619,917 (GRCm39)	M276K	probably benign	Het
Vmn1r26	T	C	6: 57,985,647 (GRCm39)	T181A	probably benign	Het
Vwa7	T	A	17: 35,236,770 (GRCm39)	N112K	probably damaging	Het
Xkr7	C	T	2: 152,896,343 (GRCm39)	T399I	probably damaging	Het
Zpld2	T	C	4: 133,930,248 (GRCm39)	D19G	probably benign	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81,121,697 (GRCm39)	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81,126,687 (GRCm39)	splice site	probably benign
IGL01876:Ap3b2	APN	7	81,123,602 (GRCm39)	splice site	probably null
IGL02132:Ap3b2	APN	7	81,110,746 (GRCm39)	missense	unknown
IGL02227:Ap3b2	APN	7	81,123,152 (GRCm39)	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81,115,446 (GRCm39)	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81,115,941 (GRCm39)	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81,115,941 (GRCm39)	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81,122,828 (GRCm39)	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81,113,429 (GRCm39)	splice site	probably null
R0568:Ap3b2	UTSW	7	81,114,377 (GRCm39)	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81,113,659 (GRCm39)	missense	unknown
R1160:Ap3b2	UTSW	7	81,115,917 (GRCm39)	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81,113,438 (GRCm39)	nonsense	probably null
R1542:Ap3b2	UTSW	7	81,127,825 (GRCm39)	splice site	probably null
R1652:Ap3b2	UTSW	7	81,123,147 (GRCm39)	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81,117,347 (GRCm39)	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81,113,898 (GRCm39)	missense	unknown
R2065:Ap3b2	UTSW	7	81,113,522 (GRCm39)	missense	unknown
R2353:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81,126,943 (GRCm39)	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81,127,765 (GRCm39)	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81,126,884 (GRCm39)	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81,121,680 (GRCm39)	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81,121,680 (GRCm39)	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81,127,678 (GRCm39)	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81,126,517 (GRCm39)	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81,126,500 (GRCm39)	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81,143,340 (GRCm39)	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81,123,210 (GRCm39)	nonsense	probably null
R6901:Ap3b2	UTSW	7	81,134,660 (GRCm39)	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81,127,741 (GRCm39)	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81,110,757 (GRCm39)	missense	unknown
R7317:Ap3b2	UTSW	7	81,110,776 (GRCm39)	missense	unknown
R7501:Ap3b2	UTSW	7	81,123,194 (GRCm39)	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81,115,894 (GRCm39)	splice site	probably null
R7643:Ap3b2	UTSW	7	81,126,820 (GRCm39)	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81,126,530 (GRCm39)	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81,113,530 (GRCm39)	missense	unknown
R8273:Ap3b2	UTSW	7	81,112,990 (GRCm39)	missense	unknown
R8325:Ap3b2	UTSW	7	81,134,237 (GRCm39)	splice site	probably null
R8355:Ap3b2	UTSW	7	81,122,851 (GRCm39)	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81,122,783 (GRCm39)	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81,126,901 (GRCm39)	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81,126,931 (GRCm39)	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81,117,192 (GRCm39)	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81,113,546 (GRCm39)	missense	unknown
R9304:Ap3b2	UTSW	7	81,113,019 (GRCm39)	missense	unknown
R9321:Ap3b2	UTSW	7	81,114,252 (GRCm39)	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81,127,757 (GRCm39)	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81,123,651 (GRCm39)	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81,126,092 (GRCm39)	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81,112,988 (GRCm39)	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81,113,512 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGAAGGCATAGTCCACAGACAG -3'
(R):5'- AGCCCAGTATGGCTTAAGAGGCAC -3'

Sequencing Primer
(F):5'- AATGCTGGACACTGGACTC -3'
(R):5'- CTTAAGAGGCACTCTGGGAGC -3'

Posted On

2014-01-05