Incidental Mutation 'R1121:Ap3b2'
ID95632
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81464195 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 815 (T815S)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
Predicted Effect unknown
Transcript: ENSMUST00000082090
AA Change: T815S
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: T815S

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147624
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 intron probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAAGGCATAGTCCACAGACAG -3'
(R):5'- AGCCCAGTATGGCTTAAGAGGCAC -3'

Sequencing Primer
(F):5'- AATGCTGGACACTGGACTC -3'
(R):5'- CTTAAGAGGCACTCTGGGAGC -3'
Posted On2014-01-05