Incidental Mutation 'R1121:6430531B16Rik'
ID95636
Institutional Source Beutler Lab
Gene Symbol 6430531B16Rik
Ensembl Gene ENSMUSG00000073795
Gene NameRIKEN cDNA 6430531B16 gene
SynonymsLOC381933
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139972303-139978755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139976630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 148 (D148V)
Ref Sequence ENSEMBL: ENSMUSP00000148257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000097970] [ENSMUST00000106069] [ENSMUST00000121412] [ENSMUST00000209335] [ENSMUST00000210254]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097970
AA Change: D148V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795
AA Change: D148V

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121412
AA Change: D148V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113338
Gene: ENSMUSG00000073795
AA Change: D148V

DomainStartEndE-ValueType
Pfam:DUF1042 22 153 4.5e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.3e-20 PFAM
low complexity region 230 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect probably benign
Transcript: ENSMUST00000209335
AA Change: D148V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000210254
AA Change: D148V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in 6430531B16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:6430531B16Rik APN 7 139978103 missense probably damaging 1.00
IGL01900:6430531B16Rik APN 7 139972570 missense probably damaging 1.00
IGL03395:6430531B16Rik APN 7 139976676 splice site probably benign
R0562:6430531B16Rik UTSW 7 139977113 missense probably benign 0.01
R1474:6430531B16Rik UTSW 7 139976642 missense probably benign
R1844:6430531B16Rik UTSW 7 139976092 missense probably benign 0.06
R2680:6430531B16Rik UTSW 7 139978561 missense probably damaging 1.00
R3113:6430531B16Rik UTSW 7 139975965 splice site probably benign
R4478:6430531B16Rik UTSW 7 139975860 critical splice donor site probably null
R4576:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R4577:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R5037:6430531B16Rik UTSW 7 139978674 missense possibly damaging 0.84
R5935:6430531B16Rik UTSW 7 139976613 missense probably benign 0.37
R6314:6430531B16Rik UTSW 7 139976489 missense possibly damaging 0.92
R6361:6430531B16Rik UTSW 7 139976672 missense possibly damaging 0.55
R7326:6430531B16Rik UTSW 7 139978545 critical splice donor site probably null
R7386:6430531B16Rik UTSW 7 139976052 nonsense probably null
R7658:6430531B16Rik UTSW 7 139976618 missense probably benign
R8300:6430531B16Rik UTSW 7 139977178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTATGCCTTCCTCAGGAGCCCAC -3'
(R):5'- GCCCTTTGCACTCAGTCAGACAATC -3'

Sequencing Primer
(F):5'- GAGCCCACTAGCCTCTCTG -3'
(R):5'- TAACCCCACCCAGAGTTTGT -3'
Posted On2014-01-05