Incidental Mutation 'R1121:Islr'
ID95645
Institutional Source Beutler Lab
Gene Symbol Islr
Ensembl Gene ENSMUSG00000037206
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat
Synonyms
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58156268-58204306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58157762 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 154 (N154S)
Ref Sequence ENSEMBL: ENSMUSP00000126963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000041477] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000168864] [ENSMUST00000170397] [ENSMUST00000217578]
Predicted Effect probably benign
Transcript: ENSMUST00000034880
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041477
AA Change: N154S

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045142
Gene: ENSMUSG00000037206
AA Change: N154S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168864
AA Change: N154S

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126963
Gene: ENSMUSG00000037206
AA Change: N154S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: The gene product suppresses differentiation of bone marrow stromal and skeletal stem cells into skeletal lineages. Homozygous knockout leads to growth retardation and longer long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Islr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Islr APN 9 58157228 missense probably damaging 1.00
IGL02169:Islr APN 9 58158132 missense possibly damaging 0.92
IGL02369:Islr APN 9 58157624 missense probably damaging 1.00
IGL02930:Islr APN 9 58158200 unclassified probably benign
PIT4581001:Islr UTSW 9 58157201 missense possibly damaging 0.92
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1638:Islr UTSW 9 58158219 unclassified probably benign
R1699:Islr UTSW 9 58157495 missense probably damaging 1.00
R4360:Islr UTSW 9 58157604 missense probably damaging 1.00
R4677:Islr UTSW 9 58157359 missense probably damaging 1.00
R4707:Islr UTSW 9 58157687 missense possibly damaging 0.75
R4856:Islr UTSW 9 58157606 missense probably damaging 0.99
R5354:Islr UTSW 9 58157612 missense probably damaging 1.00
R6343:Islr UTSW 9 58157096 missense probably damaging 1.00
R6768:Islr UTSW 9 58157610 missense possibly damaging 0.75
R7050:Islr UTSW 9 58157717 missense probably damaging 1.00
R7216:Islr UTSW 9 58156967 missense unknown
R8209:Islr UTSW 9 58158057 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTGGGATACCCTTCAGGACGTG -3'
(R):5'- TTGCAGACTGTGCCTATCGTGACC -3'

Sequencing Primer
(F):5'- CCTTCAGGACGTGGGGTG -3'
(R):5'- CTGTGCCTATCGTGACCTAGAG -3'
Posted On2014-01-05