Incidental Mutation 'R1121:Prtg'
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72906167 bp
Amino Acid Change Histidine to Glutamine at position 936 (H936Q)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably benign
Transcript: ENSMUST00000055535
AA Change: H936Q

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: H936Q

signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184274
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1438:Prtg UTSW 9 72910750 splice site probably benign
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5563:Prtg UTSW 9 72856898 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5738:Prtg UTSW 9 72912006 missense probably benign 0.16
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5961:Prtg UTSW 9 72856946 missense probably benign
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7324:Prtg UTSW 9 72890840 missense probably damaging 0.96
R7372:Prtg UTSW 9 72851566 nonsense probably null
R7808:Prtg UTSW 9 72842697 missense possibly damaging 0.81
R8069:Prtg UTSW 9 72844983 missense probably benign 0.10
R8262:Prtg UTSW 9 72906238 missense probably benign 0.00
R8280:Prtg UTSW 9 72906151 missense probably damaging 0.99
R8290:Prtg UTSW 9 72890795 missense probably damaging 1.00
R8511:Prtg UTSW 9 72890874 critical splice donor site probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Z1176:Prtg UTSW 9 72893968 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcttcctcaatcacttcccatc -3'
Posted On2014-01-05