Incidental Mutation 'R1005:Slfn5'
ID95658
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission 039115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1005 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82960158 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 427 (L427H)
Ref Sequence ENSEMBL: ENSMUSP00000103792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably damaging
Transcript: ENSMUST00000067443
AA Change: L427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: L427H

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108157
AA Change: L427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: L427H

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108158
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216469
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,665,514 D163G probably benign Het
Adck1 G A 12: 88,402,102 V117M probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa6 A T 11: 55,001,218 M304K possibly damaging Het
Aox1 A G 1: 58,065,352 T563A probably benign Het
AW551984 G A 9: 39,593,733 Q488* probably null Het
Cbx2 A G 11: 119,028,574 R322G probably benign Het
Csmd1 T A 8: 16,288,693 T467S probably damaging Het
Cspg4 A G 9: 56,888,736 I1252V probably benign Het
Enah A T 1: 181,961,930 probably benign Het
Fam171a2 T C 11: 102,440,181 M185V probably benign Het
Flt1 G T 5: 147,681,885 N213K probably damaging Het
Fpr-rs3 T C 17: 20,624,084 N265S probably benign Het
Gbp2 T C 3: 142,630,501 probably benign Het
Gm6871 A T 7: 41,546,258 C352S probably damaging Het
Gm9742 T C 13: 8,035,215 noncoding transcript Het
Iars T C 13: 49,687,445 I18T possibly damaging Het
Kel T C 6: 41,688,617 Y523C probably damaging Het
Klk1b8 T A 7: 43,954,334 C198* probably null Het
Mc3r A G 2: 172,249,563 H235R probably benign Het
Nr0b2 G T 4: 133,553,474 R17L probably benign Het
Olfr43 A G 11: 74,207,136 F27L probably benign Het
Prl7a1 G A 13: 27,642,446 P2L possibly damaging Het
Prrt3 G A 6: 113,494,778 A811V probably damaging Het
Rab28 A G 5: 41,698,383 probably benign Het
Rhobtb2 A G 14: 69,798,277 L115P probably damaging Het
Robo4 A G 9: 37,408,251 E599G probably damaging Het
Ros1 T A 10: 52,128,405 probably benign Het
Slc22a27 A T 19: 7,926,751 L7Q probably damaging Het
Smarcad1 C T 6: 65,108,727 H890Y probably benign Het
Snx31 A G 15: 36,517,691 probably benign Het
Sptb C T 12: 76,601,859 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ston2 T C 12: 91,648,848 D262G possibly damaging Het
Trank1 T G 9: 111,333,721 M16R probably benign Het
Trrap A G 5: 144,805,727 E1385G probably damaging Het
Ttc8 T C 12: 98,937,144 S47P probably benign Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGTCTAGTGTCACCCAACAGGA -3'
(R):5'- CCACCTGCTGTGTGGTTATGAAGT -3'

Sequencing Primer
(F):5'- GGATTACATATACTCCAGAGAGCGTC -3'
(R):5'- GGGAATGATGCCTAATCTTCCAG -3'
Posted On2014-01-05