Incidental Mutation 'R1121:G6pc3'
ID95659
Institutional Source Beutler Lab
Gene Symbol G6pc3
Ensembl Gene ENSMUSG00000034793
Gene Nameglucose 6 phosphatase, catalytic, 3
Synonyms0710001K01Rik
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1121 (G1)
Quality Score132
Status Not validated
Chromosome11
Chromosomal Location102189620-102194081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102189942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 6 (S6N)
Ref Sequence ENSEMBL: ENSMUSP00000077995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021297] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107151] [ENSMUST00000107156]
Predicted Effect probably benign
Transcript: ENSMUST00000021297
SMART Domains Protein: ENSMUSP00000021297
Gene: ENSMUSG00000020922

DomainStartEndE-ValueType
AD 78 165 5.73e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070334
AA Change: S6N

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793
AA Change: S6N

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078975
AA Change: S6N

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793
AA Change: S6N

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107151
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107156
SMART Domains Protein: ENSMUSP00000102774
Gene: ENSMUSG00000020922

DomainStartEndE-ValueType
AD 21 107 1.31e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153276
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in females, but not males, that are growth retarded and weight less and exhibit elevated plasma glucagon levels but lowered plasma cholesterols after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in G6pc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:G6pc3 APN 11 102193105 missense probably benign 0.01
PIT4378001:G6pc3 UTSW 11 102190001 missense probably damaging 1.00
R4844:G6pc3 UTSW 11 102193231 splice site probably null
R6736:G6pc3 UTSW 11 102193670 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGAAACAGTACCAGCTACGGCTC -3'
(R):5'- CCACTCAGCAATGAAGGTGATCCAG -3'

Sequencing Primer
(F):5'- GTGTCAGGGACTgcggg -3'
(R):5'- TCCAGAGCACGGAGATGC -3'
Posted On2014-01-05