Incidental Mutation 'R1005:Cbx2'
ID95662
Institutional Source Beutler Lab
Gene Symbol Cbx2
Ensembl Gene ENSMUSG00000025577
Gene Namechromobox 2
SynonymsM33
MMRRC Submission 039115-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1005 (G1)
Quality Score192
Status Validated
Chromosome11
Chromosomal Location119022962-119031270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119028574 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 322 (R322G)
Ref Sequence ENSEMBL: ENSMUSP00000026662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026662]
Predicted Effect probably benign
Transcript: ENSMUST00000026662
AA Change: R322G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026662
Gene: ENSMUSG00000025577
AA Change: R322G

DomainStartEndE-ValueType
CHROMO 11 63 5.74e-17 SMART
AT_hook 74 86 2.05e-1 SMART
low complexity region 102 132 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 301 318 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139746
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in results in male-to-female gonadal sex reversal. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations cause malformations of the axial skeletal, reduced viability, poor growth and male to female sex reversal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,665,514 D163G probably benign Het
Adck1 G A 12: 88,402,102 V117M probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa6 A T 11: 55,001,218 M304K possibly damaging Het
Aox1 A G 1: 58,065,352 T563A probably benign Het
AW551984 G A 9: 39,593,733 Q488* probably null Het
Csmd1 T A 8: 16,288,693 T467S probably damaging Het
Cspg4 A G 9: 56,888,736 I1252V probably benign Het
Enah A T 1: 181,961,930 probably benign Het
Fam171a2 T C 11: 102,440,181 M185V probably benign Het
Flt1 G T 5: 147,681,885 N213K probably damaging Het
Fpr-rs3 T C 17: 20,624,084 N265S probably benign Het
Gbp2 T C 3: 142,630,501 probably benign Het
Gm6871 A T 7: 41,546,258 C352S probably damaging Het
Gm9742 T C 13: 8,035,215 noncoding transcript Het
Iars T C 13: 49,687,445 I18T possibly damaging Het
Kel T C 6: 41,688,617 Y523C probably damaging Het
Klk1b8 T A 7: 43,954,334 C198* probably null Het
Mc3r A G 2: 172,249,563 H235R probably benign Het
Nr0b2 G T 4: 133,553,474 R17L probably benign Het
Olfr43 A G 11: 74,207,136 F27L probably benign Het
Prl7a1 G A 13: 27,642,446 P2L possibly damaging Het
Prrt3 G A 6: 113,494,778 A811V probably damaging Het
Rab28 A G 5: 41,698,383 probably benign Het
Rhobtb2 A G 14: 69,798,277 L115P probably damaging Het
Robo4 A G 9: 37,408,251 E599G probably damaging Het
Ros1 T A 10: 52,128,405 probably benign Het
Slc22a27 A T 19: 7,926,751 L7Q probably damaging Het
Slfn5 T A 11: 82,960,158 L427H probably damaging Het
Smarcad1 C T 6: 65,108,727 H890Y probably benign Het
Snx31 A G 15: 36,517,691 probably benign Het
Sptb C T 12: 76,601,859 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ston2 T C 12: 91,648,848 D262G possibly damaging Het
Trank1 T G 9: 111,333,721 M16R probably benign Het
Trrap A G 5: 144,805,727 E1385G probably damaging Het
Ttc8 T C 12: 98,937,144 S47P probably benign Het
Other mutations in Cbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1629:Cbx2 UTSW 11 119028980 missense probably damaging 0.99
R1954:Cbx2 UTSW 11 119028340 missense probably damaging 0.99
R1962:Cbx2 UTSW 11 119028569 missense possibly damaging 0.76
R4674:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R4675:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R5558:Cbx2 UTSW 11 119028949 missense probably benign 0.01
R6446:Cbx2 UTSW 11 119027926 missense probably benign 0.08
R6550:Cbx2 UTSW 11 119029025 missense possibly damaging 0.63
R6610:Cbx2 UTSW 11 119024210 missense probably damaging 1.00
R6622:Cbx2 UTSW 11 119029135 missense probably damaging 0.99
R7095:Cbx2 UTSW 11 119028059 missense probably damaging 1.00
R7132:Cbx2 UTSW 11 119023121 missense probably benign 0.08
R7478:Cbx2 UTSW 11 119029115 missense probably damaging 1.00
R8296:Cbx2 UTSW 11 119028128 missense probably damaging 1.00
R8374:Cbx2 UTSW 11 119028143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAACCGCATGAGCCAGAGTCAG -3'
(R):5'- AGCGACGCTTTTAACGGTGTCC -3'

Sequencing Primer
(F):5'- AGAGTCAGGTTCAGGCTGC -3'
(R):5'- TAACGGTGTCCCGCTTGAC -3'
Posted On2014-01-05