Incidental Mutation 'R1005:Adck1'
ID95668
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene NameaarF domain containing kinase 1
Synonyms2610005A10Rik
MMRRC Submission 039115-MU
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1005 (G1)
Quality Score175
Status Validated
Chromosome12
Chromosomal Location88360554-88461724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88402102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 117 (V117M)
Ref Sequence ENSEMBL: ENSMUSP00000152821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
Predicted Effect probably damaging
Transcript: ENSMUST00000101165
AA Change: V117M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: V117M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166940
AA Change: V117M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: V117M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222695
AA Change: V117M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.5%
Validation Efficiency 100% (41/41)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,665,514 D163G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa6 A T 11: 55,001,218 M304K possibly damaging Het
Aox1 A G 1: 58,065,352 T563A probably benign Het
AW551984 G A 9: 39,593,733 Q488* probably null Het
Cbx2 A G 11: 119,028,574 R322G probably benign Het
Csmd1 T A 8: 16,288,693 T467S probably damaging Het
Cspg4 A G 9: 56,888,736 I1252V probably benign Het
Enah A T 1: 181,961,930 probably benign Het
Fam171a2 T C 11: 102,440,181 M185V probably benign Het
Flt1 G T 5: 147,681,885 N213K probably damaging Het
Fpr-rs3 T C 17: 20,624,084 N265S probably benign Het
Gbp2 T C 3: 142,630,501 probably benign Het
Gm6871 A T 7: 41,546,258 C352S probably damaging Het
Gm9742 T C 13: 8,035,215 noncoding transcript Het
Iars T C 13: 49,687,445 I18T possibly damaging Het
Kel T C 6: 41,688,617 Y523C probably damaging Het
Klk1b8 T A 7: 43,954,334 C198* probably null Het
Mc3r A G 2: 172,249,563 H235R probably benign Het
Nr0b2 G T 4: 133,553,474 R17L probably benign Het
Olfr43 A G 11: 74,207,136 F27L probably benign Het
Prl7a1 G A 13: 27,642,446 P2L possibly damaging Het
Prrt3 G A 6: 113,494,778 A811V probably damaging Het
Rab28 A G 5: 41,698,383 probably benign Het
Rhobtb2 A G 14: 69,798,277 L115P probably damaging Het
Robo4 A G 9: 37,408,251 E599G probably damaging Het
Ros1 T A 10: 52,128,405 probably benign Het
Slc22a27 A T 19: 7,926,751 L7Q probably damaging Het
Slfn5 T A 11: 82,960,158 L427H probably damaging Het
Smarcad1 C T 6: 65,108,727 H890Y probably benign Het
Snx31 A G 15: 36,517,691 probably benign Het
Sptb C T 12: 76,601,859 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ston2 T C 12: 91,648,848 D262G possibly damaging Het
Trank1 T G 9: 111,333,721 M16R probably benign Het
Trrap A G 5: 144,805,727 E1385G probably damaging Het
Ttc8 T C 12: 98,937,144 S47P probably benign Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7520:Adck1 UTSW 12 88459205 critical splice donor site probably null
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
R7745:Adck1 UTSW 12 88456800 missense probably benign
R7759:Adck1 UTSW 12 88402117 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCAGGGAACAGACTGCACTCACTC -3'
(R):5'- AGCTTCTGGTTCAGCACCGAATG -3'

Sequencing Primer
(F):5'- AGACTGCACTCACTCCTCTTG -3'
(R):5'- CTGAGACATGTGATTCTGCATC -3'
Posted On2014-01-05