Incidental Mutation 'R1121:Dpysl2'
ID95677
Institutional Source Beutler Lab
Gene Symbol Dpysl2
Ensembl Gene ENSMUSG00000022048
Gene Namedihydropyrimidinase-like 2
SynonymsDRP2, Crmp2, Ulip2, TOAD-64
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66802864-66868688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66862552 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 78 (M78I)
Ref Sequence ENSEMBL: ENSMUSP00000022629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022629]
Predicted Effect probably benign
Transcript: ENSMUST00000022629
AA Change: M78I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022629
Gene: ENSMUSG00000022048
AA Change: M78I

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.3e-54 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collapsin response mediator protein family. Collapsin response mediator proteins form homo- and hetero-tetramers and facilitate neuron guidance, growth and polarity. The encoded protein promotes microtubule assembly and is required for Sema3A-mediated growth cone collapse, and also plays a role in synaptic signaling through interactions with calcium channels. This gene has been implicated in multiple neurological disorders, and hyperphosphorylation of the encoded protein may play a key role in the development of Alzheimer's disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal dendritic patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Pnlip A G 19: 58,680,908 probably null Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Dpysl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Dpysl2 APN 14 66834232 missense probably damaging 1.00
IGL01451:Dpysl2 APN 14 66807918 missense possibly damaging 0.64
IGL02080:Dpysl2 APN 14 66829945 missense probably benign 0.01
IGL02313:Dpysl2 APN 14 66824390 missense probably benign 0.01
IGL02530:Dpysl2 APN 14 66824398 missense probably damaging 1.00
IGL03082:Dpysl2 APN 14 66808010 missense probably damaging 1.00
IGL03357:Dpysl2 APN 14 66813287 missense probably damaging 0.97
R0491:Dpysl2 UTSW 14 66807962 missense probably damaging 1.00
R0564:Dpysl2 UTSW 14 66805446 splice site probably benign
R1190:Dpysl2 UTSW 14 66824401 missense probably benign 0.17
R1595:Dpysl2 UTSW 14 66815503 missense probably damaging 1.00
R1786:Dpysl2 UTSW 14 66862665 splice site probably benign
R1830:Dpysl2 UTSW 14 66868391 unclassified probably benign
R2076:Dpysl2 UTSW 14 66865122 missense probably damaging 1.00
R3615:Dpysl2 UTSW 14 66834370 missense probably damaging 1.00
R3616:Dpysl2 UTSW 14 66834370 missense probably damaging 1.00
R3928:Dpysl2 UTSW 14 66824431 missense possibly damaging 0.71
R4209:Dpysl2 UTSW 14 66815477 missense probably damaging 0.98
R4211:Dpysl2 UTSW 14 66815477 missense probably damaging 0.98
R4793:Dpysl2 UTSW 14 66815049 missense possibly damaging 0.93
R4859:Dpysl2 UTSW 14 66829439 missense probably damaging 1.00
R5640:Dpysl2 UTSW 14 66834368 missense probably benign 0.43
R5708:Dpysl2 UTSW 14 66813146 missense probably benign 0.07
R5808:Dpysl2 UTSW 14 66865172 critical splice acceptor site probably null
R7045:Dpysl2 UTSW 14 66829946 missense probably benign 0.06
R7140:Dpysl2 UTSW 14 66862533 missense probably benign 0.00
R7211:Dpysl2 UTSW 14 66829976 missense probably damaging 0.99
R7316:Dpysl2 UTSW 14 66862595 missense possibly damaging 0.94
R7361:Dpysl2 UTSW 14 66834215 missense possibly damaging 0.95
R7772:Dpysl2 UTSW 14 66828976 splice site probably null
R7852:Dpysl2 UTSW 14 66862643 missense probably benign 0.07
Z1177:Dpysl2 UTSW 14 66862490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCGTTCACCCAAGGGAAGATTC -3'
(R):5'- TGCTGCCTCGTGTAAGTTACCG -3'

Sequencing Primer
(F):5'- GAAGATTCTAGTGTCACAGGCTC -3'
(R):5'- gccaaggctgaccttgaac -3'
Posted On2014-01-05