Incidental Mutation 'R1121:Pnlip'
ID95694
Institutional Source Beutler Lab
Gene Symbol Pnlip
Ensembl Gene ENSMUSG00000046008
Gene Namepancreatic lipase
Synonymspancreatic triglyceride lipase, PTL, 1810007A24Rik
MMRRC Submission 039194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1121 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location58670365-58681786 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 58680908 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057270] [ENSMUST00000057270]
Predicted Effect probably null
Transcript: ENSMUST00000057270
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057270
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice show impaired dietary cholesterol, triglyceride and retinyl ester absorption, resistance to diet-induced obesity, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T A 7: 139,976,630 D148V probably benign Het
Aldh1l1 A T 6: 90,589,384 I646L probably benign Het
Ankar G A 1: 72,651,663 probably null Het
Ap3b2 T A 7: 81,464,195 T815S unknown Het
Cops7a T C 6: 124,962,416 D90G probably benign Het
Dpysl2 C T 14: 66,862,552 M78I probably benign Het
Erc2 T C 14: 28,475,655 probably benign Het
Fam120a A T 13: 48,910,437 probably null Het
Fam214b T C 4: 43,034,947 K317E probably damaging Het
Fam98a C A 17: 75,538,534 G406C unknown Het
G6pc3 G A 11: 102,189,942 S6N possibly damaging Het
Gm7534 T C 4: 134,202,937 D19G probably benign Het
Grin2d T G 7: 45,854,347 M655L probably damaging Het
Hnrnpul1 G T 7: 25,740,907 T308K possibly damaging Het
Ipp T A 4: 116,520,675 N247K probably benign Het
Islr T C 9: 58,157,762 N154S probably benign Het
Itk A G 11: 46,331,894 Y577H possibly damaging Het
Micu1 C T 10: 59,788,982 T282I possibly damaging Het
Olfr214 T G 6: 116,557,229 V268G probably damaging Het
Pcdhb14 T A 18: 37,449,592 Y584N probably damaging Het
Ppip5k2 A T 1: 97,756,860 Y129N probably damaging Het
Prtg T G 9: 72,906,167 H936Q probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Sptbn5 T A 2: 120,069,390 probably null Het
Thnsl1 A G 2: 21,212,164 D243G probably benign Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Uhrf1 T A 17: 56,312,917 M276K probably benign Het
Vmn1r26 T C 6: 58,008,662 T181A probably benign Het
Vwa7 T A 17: 35,017,794 N112K probably damaging Het
Xkr7 C T 2: 153,054,423 T399I probably damaging Het
Other mutations in Pnlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Pnlip APN 19 58673874 missense probably benign 0.00
IGL02733:Pnlip APN 19 58680788 missense probably benign
R2145:Pnlip UTSW 19 58676444 missense probably benign 0.11
R2213:Pnlip UTSW 19 58673770 missense probably benign 0.07
R3405:Pnlip UTSW 19 58680759 missense probably benign
R4703:Pnlip UTSW 19 58676467 missense probably damaging 1.00
R4731:Pnlip UTSW 19 58676487 missense probably benign 0.00
R4909:Pnlip UTSW 19 58676240 missense possibly damaging 0.85
R5386:Pnlip UTSW 19 58679607 missense probably benign 0.25
R5444:Pnlip UTSW 19 58673163 missense probably benign 0.00
R5851:Pnlip UTSW 19 58673792 nonsense probably null
R6515:Pnlip UTSW 19 58673115 missense probably damaging 1.00
R6605:Pnlip UTSW 19 58671742 missense probably benign 0.20
R6974:Pnlip UTSW 19 58679635 critical splice donor site probably null
R7057:Pnlip UTSW 19 58676263 missense probably damaging 1.00
R7312:Pnlip UTSW 19 58681702 missense probably damaging 0.97
R7358:Pnlip UTSW 19 58676544 missense probably damaging 1.00
R7476:Pnlip UTSW 19 58679634 critical splice donor site probably null
R7674:Pnlip UTSW 19 58675154 missense possibly damaging 0.70
R7800:Pnlip UTSW 19 58681702 missense probably benign 0.18
R7983:Pnlip UTSW 19 58680059 missense probably benign 0.04
X0025:Pnlip UTSW 19 58680810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGTGGGAATTTACTCCAGGCGT -3'
(R):5'- TGTCAGTCACTACACAAAGGACCAGAA -3'

Sequencing Primer
(F):5'- GACATCTTAACTTCTCAGGGGC -3'
(R):5'- atgccacgaacagtgcc -3'
Posted On2014-01-05