Incidental Mutation 'R1122:Rem1'
ID95715
Institutional Source Beutler Lab
Gene Symbol Rem1
Ensembl Gene ENSMUSG00000000359
Gene Namerad and gem related GTP binding protein 1
SynonymsE030011C07Rik
MMRRC Submission 039195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1122 (G1)
Quality Score161
Status Not validated
Chromosome2
Chromosomal Location152626951-152635198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152634535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 238 (V238M)
Ref Sequence ENSEMBL: ENSMUSP00000000369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000369]
Predicted Effect probably damaging
Transcript: ENSMUST00000000369
AA Change: V238M

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000369
Gene: ENSMUSG00000000359
AA Change: V238M

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:Roc 82 198 1e-10 PFAM
Pfam:Ras 82 244 2.6e-32 PFAM
low complexity region 258 290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139370
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase and member of the RAS-like GTP-binding protein family. The encoded protein is expressed in endothelial cells, where it promotes reorganization of the actin cytoskeleton and morphological changes in the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl G A 11: 70,011,377 L469F probably damaging Het
Adgrb1 C A 15: 74,547,685 R792S probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap15 A T 2: 44,142,295 H297L probably benign Het
BC003965 T C 17: 25,184,872 I62T probably benign Het
Chtf18 T C 17: 25,724,623 E333G probably damaging Het
Cyb5a A G 18: 84,877,839 T77A possibly damaging Het
Exosc10 T C 4: 148,566,364 W456R possibly damaging Het
Fam160b1 A T 19: 57,382,301 T551S probably benign Het
Fam189a2 T C 19: 23,975,392 E518G probably damaging Het
Gad2 A T 2: 22,623,451 Q31L possibly damaging Het
Gm9637 T A 14: 19,401,879 noncoding transcript Het
Itgav A G 2: 83,791,939 T622A probably benign Het
Kifc5b T A 17: 26,924,061 V269E probably benign Het
Lrrc15 T C 16: 30,273,901 N207D probably damaging Het
Map2k5 A G 9: 63,263,163 V291A probably damaging Het
Mrc1 G A 2: 14,261,336 probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr101 T A 17: 37,300,128 Q98L probably damaging Het
Olfr97 T A 17: 37,232,043 D109V probably damaging Het
Pdzd2 A G 15: 12,457,895 V294A probably benign Het
Rnf220 C T 4: 117,278,080 G171S probably benign Het
Slc6a4 T C 11: 77,027,186 S585P possibly damaging Het
Slc7a8 T C 14: 54,724,107 E528G probably benign Het
Slco4c1 A G 1: 96,828,836 I587T possibly damaging Het
Syt4 T A 18: 31,440,202 H420L probably damaging Het
Tec T C 5: 72,779,449 K236E probably damaging Het
Ttn A G 2: 76,715,332 V32549A probably damaging Het
Wdfy3 T C 5: 101,882,966 H2299R possibly damaging Het
Zfp729b A G 13: 67,595,284 V64A possibly damaging Het
Other mutations in Rem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1121:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1126:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1233:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1235:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1378:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1709:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1713:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1911:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1912:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R5442:Rem1 UTSW 2 152628057 critical splice acceptor site probably null
R5853:Rem1 UTSW 2 152628280 missense possibly damaging 0.92
R6062:Rem1 UTSW 2 152628097 start codon destroyed probably null 1.00
R6072:Rem1 UTSW 2 152634517 missense probably benign
R7215:Rem1 UTSW 2 152628149 missense probably damaging 1.00
R7635:Rem1 UTSW 2 152634665 missense probably damaging 1.00
X0057:Rem1 UTSW 2 152629191 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTTCCTGAGAGTTTGAACACA -3'
(R):5'- CTTTTCTCCTCAGTGGCACCATA -3'

Sequencing Primer
(F):5'- CATCTCTTCCCACCTTTATC -3'
(R):5'- ATAGTGTCCCATCACCCCAG -3'
Posted On2014-01-05