Incidental Mutation 'R1122:Exosc10'
ID95723
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 039195-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1122 (G1)
Quality Score215
Status Not validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148566364 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 456 (W456R)
Ref Sequence ENSEMBL: ENSMUSP00000075401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: W456R

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: W456R

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076022
AA Change: W456R

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: W456R

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
AA Change: W456R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: W456R

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126897
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl G A 11: 70,011,377 L469F probably damaging Het
Adgrb1 C A 15: 74,547,685 R792S probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap15 A T 2: 44,142,295 H297L probably benign Het
BC003965 T C 17: 25,184,872 I62T probably benign Het
Chtf18 T C 17: 25,724,623 E333G probably damaging Het
Cyb5a A G 18: 84,877,839 T77A possibly damaging Het
Fam160b1 A T 19: 57,382,301 T551S probably benign Het
Fam189a2 T C 19: 23,975,392 E518G probably damaging Het
Gad2 A T 2: 22,623,451 Q31L possibly damaging Het
Gm9637 T A 14: 19,401,879 noncoding transcript Het
Itgav A G 2: 83,791,939 T622A probably benign Het
Kifc5b T A 17: 26,924,061 V269E probably benign Het
Lrrc15 T C 16: 30,273,901 N207D probably damaging Het
Map2k5 A G 9: 63,263,163 V291A probably damaging Het
Mrc1 G A 2: 14,261,336 probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr101 T A 17: 37,300,128 Q98L probably damaging Het
Olfr97 T A 17: 37,232,043 D109V probably damaging Het
Pdzd2 A G 15: 12,457,895 V294A probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnf220 C T 4: 117,278,080 G171S probably benign Het
Slc6a4 T C 11: 77,027,186 S585P possibly damaging Het
Slc7a8 T C 14: 54,724,107 E528G probably benign Het
Slco4c1 A G 1: 96,828,836 I587T possibly damaging Het
Syt4 T A 18: 31,440,202 H420L probably damaging Het
Tec T C 5: 72,779,449 K236E probably damaging Het
Ttn A G 2: 76,715,332 V32549A probably damaging Het
Wdfy3 T C 5: 101,882,966 H2299R possibly damaging Het
Zfp729b A G 13: 67,595,284 V64A possibly damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 synonymous probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTGTCCCGTTGGAAAGGAAAA -3'
(R):5'- AGCTATAACTCATTCCCTCCCCTGG -3'

Sequencing Primer
(F):5'- TCCCGTTGGAAAGGAAAAAATCATTG -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2014-01-05