Incidental Mutation 'R1006:Flg2'
ID 95727
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 039116-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R1006 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93108514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 181 (I181V)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000098884
AA Change: I181V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: I181V

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,911,085 (GRCm39) I282N probably benign Het
Akr1c18 T C 13: 4,186,654 (GRCm39) I265V probably benign Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Arfgef1 T C 1: 10,210,706 (GRCm39) I1788V probably benign Het
Cacng7 T A 7: 3,415,445 (GRCm39) I270N possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cnbd2 A G 2: 156,170,328 (GRCm39) I138V possibly damaging Het
Cntnap5b A G 1: 100,311,342 (GRCm39) K983E probably benign Het
Col14a1 T C 15: 55,383,331 (GRCm39) S1770P probably benign Het
Cpsf6 A T 10: 117,201,973 (GRCm39) probably benign Het
Ctsc G A 7: 87,959,037 (GRCm39) R439H probably damaging Het
Dcun1d1 A G 3: 35,951,930 (GRCm39) probably benign Het
Gbp2 A T 3: 142,343,183 (GRCm39) S567C probably damaging Het
Gm5114 A G 7: 39,058,510 (GRCm39) S370P probably damaging Het
Kcnh7 A G 2: 62,546,527 (GRCm39) V1018A probably benign Het
Kmt2a G A 9: 44,758,993 (GRCm39) A952V probably damaging Het
Krt1 C T 15: 101,756,326 (GRCm39) E340K possibly damaging Het
Lim2 T A 7: 43,084,826 (GRCm39) I141N probably damaging Het
Nlrp4a T C 7: 26,152,892 (GRCm39) V654A probably benign Het
Or5b24 T A 19: 12,912,638 (GRCm39) C179S probably damaging Het
Prr14l T C 5: 32,986,826 (GRCm39) S890G probably benign Het
Psmd14 T A 2: 61,627,726 (GRCm39) probably null Het
Ptpn13 A G 5: 103,734,655 (GRCm39) D2129G probably benign Het
Pum1 C T 4: 130,499,199 (GRCm39) T760M probably damaging Het
Rif1 A G 2: 51,975,041 (GRCm39) I317V probably damaging Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Slfn8 A T 11: 82,894,337 (GRCm39) H767Q possibly damaging Het
Sned1 G A 1: 93,184,114 (GRCm39) G114D probably damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Tenm3 A T 8: 48,681,577 (GRCm39) D2684E probably damaging Het
Tet2 T C 3: 133,182,362 (GRCm39) T1201A possibly damaging Het
Vax2 T C 6: 83,714,759 (GRCm39) S225P probably damaging Het
Vcan A G 13: 89,833,196 (GRCm39) probably null Het
Washc5 T A 15: 59,241,035 (GRCm39) Q100L probably benign Het
Washc5 G T 15: 59,241,036 (GRCm39) Q100K probably benign Het
Zc3h13 A G 14: 75,567,989 (GRCm39) D1094G probably damaging Het
Zmiz1 A G 14: 25,663,404 (GRCm39) Y1051C unknown Het
Zswim2 G A 2: 83,745,737 (GRCm39) S567L probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAAACTGGCTCTGGCCTGCAAC -3'
(R):5'- ACGGCAAGACTGATTTCCTTGTCCC -3'

Sequencing Primer
(F):5'- CCTGCAACAAGGTTCTTGG -3'
(R):5'- GTGATCTACTTGCCTGACAAGAAC -3'
Posted On 2014-01-05