Incidental Mutation 'R1006:Tet2'
ID 95729
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Name tet methylcytosine dioxygenase 2
Synonyms E130014J05Rik, Ayu17-449
MMRRC Submission 039116-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1006 (G1)
Quality Score 192
Status Validated
Chromosome 3
Chromosomal Location 133463679-133545139 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133476601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1201 (T1201A)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398]
AlphaFold Q4JK59
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: T1193A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: T1193A

low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: T1201A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: T1201A

low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197211
Predicted Effect probably benign
Transcript: ENSMUST00000198974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200203
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,458,441 I282N probably benign Het
Akr1c18 T C 13: 4,136,655 I265V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arfgef1 T C 1: 10,140,481 I1788V probably benign Het
Cacng7 T A 7: 3,366,929 I270N possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cnbd2 A G 2: 156,328,408 I138V possibly damaging Het
Cntnap5b A G 1: 100,383,617 K983E probably benign Het
Col14a1 T C 15: 55,519,935 S1770P probably benign Het
Cpsf6 A T 10: 117,366,068 probably benign Het
Ctsc G A 7: 88,309,829 R439H probably damaging Het
Dcun1d1 A G 3: 35,897,781 probably benign Het
Flg2 A G 3: 93,201,207 I181V probably benign Het
Gbp2 A T 3: 142,637,422 S567C probably damaging Het
Gm5114 A G 7: 39,409,086 S370P probably damaging Het
Kcnh7 A G 2: 62,716,183 V1018A probably benign Het
Kmt2a G A 9: 44,847,696 A952V probably damaging Het
Krt1 C T 15: 101,847,891 E340K possibly damaging Het
Lim2 T A 7: 43,435,402 I141N probably damaging Het
Nlrp4a T C 7: 26,453,467 V654A probably benign Het
Olfr1449 T A 19: 12,935,274 C179S probably damaging Het
Prr14l T C 5: 32,829,482 S890G probably benign Het
Psmd14 T A 2: 61,797,382 probably null Het
Ptpn13 A G 5: 103,586,789 D2129G probably benign Het
Pum1 C T 4: 130,771,888 T760M probably damaging Het
Rif1 A G 2: 52,085,029 I317V probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slfn8 A T 11: 83,003,511 H767Q possibly damaging Het
Sned1 G A 1: 93,256,392 G114D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tenm3 A T 8: 48,228,542 D2684E probably damaging Het
Vax2 T C 6: 83,737,777 S225P probably damaging Het
Vcan A G 13: 89,685,077 probably null Het
Washc5 T A 15: 59,369,186 Q100L probably benign Het
Washc5 G T 15: 59,369,187 Q100K probably benign Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zmiz1 A G 14: 25,662,980 Y1051C unknown Het
Zswim2 G A 2: 83,915,393 S567L probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R7978:Tet2 UTSW 3 133487665 missense possibly damaging 0.96
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
R8164:Tet2 UTSW 3 133467134 missense possibly damaging 0.85
R8236:Tet2 UTSW 3 133487786 missense probably benign 0.00
R8755:Tet2 UTSW 3 133488278 missense probably damaging 0.99
R8962:Tet2 UTSW 3 133488043 missense probably benign 0.22
R9009:Tet2 UTSW 3 133487599 missense possibly damaging 0.86
R9014:Tet2 UTSW 3 133467188 missense probably damaging 0.99
R9128:Tet2 UTSW 3 133469613 missense possibly damaging 0.85
R9166:Tet2 UTSW 3 133468172 missense probably damaging 1.00
R9190:Tet2 UTSW 3 133481386 missense possibly damaging 0.73
R9344:Tet2 UTSW 3 133469354 missense possibly damaging 0.86
R9360:Tet2 UTSW 3 133487142 missense possibly damaging 0.72
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gttcatctgtgttcatcaaggg -3'
Posted On 2014-01-05