Incidental Mutation 'R1006:Vax2'
ID95741
Institutional Source Beutler Lab
Gene Symbol Vax2
Ensembl Gene ENSMUSG00000034777
Gene Nameventral anterior homeobox 2
Synonyms
MMRRC Submission 039116-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R1006 (G1)
Quality Score141
Status Validated
Chromosome6
Chromosomal Location83711264-83738313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83737777 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000035976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037807]
Predicted Effect probably damaging
Transcript: ENSMUST00000037807
AA Change: S225P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035976
Gene: ENSMUSG00000034777
AA Change: S225P

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
HOX 102 164 3.54e-27 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 233 247 N/A INTRINSIC
Meta Mutation Damage Score 0.2961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null mutants for one allele show incomplete closure of optic fissure leading to coloboma, the frequency of which is strongly influenced by genetic background. Homozygous null mutants for 2 different alleles have abnormal projections of ventralretinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,458,441 I282N probably benign Het
Akr1c18 T C 13: 4,136,655 I265V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arfgef1 T C 1: 10,140,481 I1788V probably benign Het
Cacng7 T A 7: 3,366,929 I270N possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cnbd2 A G 2: 156,328,408 I138V possibly damaging Het
Cntnap5b A G 1: 100,383,617 K983E probably benign Het
Col14a1 T C 15: 55,519,935 S1770P probably benign Het
Cpsf6 A T 10: 117,366,068 probably benign Het
Ctsc G A 7: 88,309,829 R439H probably damaging Het
Dcun1d1 A G 3: 35,897,781 probably benign Het
Flg2 A G 3: 93,201,207 I181V probably benign Het
Gbp2 A T 3: 142,637,422 S567C probably damaging Het
Gm5114 A G 7: 39,409,086 S370P probably damaging Het
Kcnh7 A G 2: 62,716,183 V1018A probably benign Het
Kmt2a G A 9: 44,847,696 A952V probably damaging Het
Krt1 C T 15: 101,847,891 E340K possibly damaging Het
Lim2 T A 7: 43,435,402 I141N probably damaging Het
Nlrp4a T C 7: 26,453,467 V654A probably benign Het
Olfr1449 T A 19: 12,935,274 C179S probably damaging Het
Prr14l T C 5: 32,829,482 S890G probably benign Het
Psmd14 T A 2: 61,797,382 probably null Het
Ptpn13 A G 5: 103,586,789 D2129G probably benign Het
Pum1 C T 4: 130,771,888 T760M probably damaging Het
Rif1 A G 2: 52,085,029 I317V probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slfn8 A T 11: 83,003,511 H767Q possibly damaging Het
Sned1 G A 1: 93,256,392 G114D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tenm3 A T 8: 48,228,542 D2684E probably damaging Het
Tet2 T C 3: 133,476,601 T1201A possibly damaging Het
Vcan A G 13: 89,685,077 probably null Het
Washc5 T A 15: 59,369,186 Q100L probably benign Het
Washc5 G T 15: 59,369,187 Q100K probably benign Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zmiz1 A G 14: 25,662,980 Y1051C unknown Het
Zswim2 G A 2: 83,915,393 S567L probably damaging Het
Other mutations in Vax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Vax2 APN 6 83711537 missense possibly damaging 0.70
IGL02161:Vax2 APN 6 83737903 missense probably damaging 1.00
IGL02584:Vax2 APN 6 83711513 missense probably benign
R0316:Vax2 UTSW 6 83711444 missense possibly damaging 0.79
R0456:Vax2 UTSW 6 83711406 missense probably benign 0.00
R2045:Vax2 UTSW 6 83711270 start gained probably benign
R2217:Vax2 UTSW 6 83737889 missense probably damaging 0.98
R2324:Vax2 UTSW 6 83711325 missense possibly damaging 0.53
R3979:Vax2 UTSW 6 83737547 missense probably damaging 0.98
R4755:Vax2 UTSW 6 83711397 missense probably damaging 0.99
R7203:Vax2 UTSW 6 83737900 missense probably damaging 0.99
R7242:Vax2 UTSW 6 83711316 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACTTGACGCAGCTCCTCAGTACAG -3'
(R):5'- AAGTGTCACACAGGGATGGGACTC -3'

Sequencing Primer
(F):5'- cccctttaccctaccccac -3'
(R):5'- GATGGGACTCTTAAATGTCAGC -3'
Posted On2014-01-05