Incidental Mutation 'R1006:Cacng7'
ID95743
Institutional Source Beutler Lab
Gene Symbol Cacng7
Ensembl Gene ENSMUSG00000069806
Gene Namecalcium channel, voltage-dependent, gamma subunit 7
Synonyms
MMRRC Submission 039116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1006 (G1)
Quality Score115
Status Validated
Chromosome7
Chromosomal Location3332955-3368221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3366929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 270 (I270N)
Ref Sequence ENSEMBL: ENSMUSP00000090567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092891
AA Change: I270N

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090567
Gene: ENSMUSG00000069806
AA Change: I270N

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 196 4.4e-22 PFAM
Pfam:Claudin_2 18 197 2.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203497
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and indistinguishable from wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,458,441 I282N probably benign Het
Akr1c18 T C 13: 4,136,655 I265V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arfgef1 T C 1: 10,140,481 I1788V probably benign Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cnbd2 A G 2: 156,328,408 I138V possibly damaging Het
Cntnap5b A G 1: 100,383,617 K983E probably benign Het
Col14a1 T C 15: 55,519,935 S1770P probably benign Het
Cpsf6 A T 10: 117,366,068 probably benign Het
Ctsc G A 7: 88,309,829 R439H probably damaging Het
Dcun1d1 A G 3: 35,897,781 probably benign Het
Flg2 A G 3: 93,201,207 I181V probably benign Het
Gbp2 A T 3: 142,637,422 S567C probably damaging Het
Gm5114 A G 7: 39,409,086 S370P probably damaging Het
Kcnh7 A G 2: 62,716,183 V1018A probably benign Het
Kmt2a G A 9: 44,847,696 A952V probably damaging Het
Krt1 C T 15: 101,847,891 E340K possibly damaging Het
Lim2 T A 7: 43,435,402 I141N probably damaging Het
Nlrp4a T C 7: 26,453,467 V654A probably benign Het
Olfr1449 T A 19: 12,935,274 C179S probably damaging Het
Prr14l T C 5: 32,829,482 S890G probably benign Het
Psmd14 T A 2: 61,797,382 probably null Het
Ptpn13 A G 5: 103,586,789 D2129G probably benign Het
Pum1 C T 4: 130,771,888 T760M probably damaging Het
Rif1 A G 2: 52,085,029 I317V probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slfn8 A T 11: 83,003,511 H767Q possibly damaging Het
Sned1 G A 1: 93,256,392 G114D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tenm3 A T 8: 48,228,542 D2684E probably damaging Het
Tet2 T C 3: 133,476,601 T1201A possibly damaging Het
Vax2 T C 6: 83,737,777 S225P probably damaging Het
Vcan A G 13: 89,685,077 probably null Het
Washc5 T A 15: 59,369,186 Q100L probably benign Het
Washc5 G T 15: 59,369,187 Q100K probably benign Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zmiz1 A G 14: 25,662,980 Y1051C unknown Het
Zswim2 G A 2: 83,915,393 S567L probably damaging Het
Other mutations in Cacng7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Cacng7 APN 7 3366031 missense probably damaging 1.00
R3115:Cacng7 UTSW 7 3338934 missense probably benign 0.16
R4610:Cacng7 UTSW 7 3336691 missense probably benign 0.07
R5357:Cacng7 UTSW 7 3338936 missense probably benign 0.07
R5596:Cacng7 UTSW 7 3366904 missense probably benign 0.21
R5735:Cacng7 UTSW 7 3339023 missense probably benign 0.11
R6222:Cacng7 UTSW 7 3336612 missense probably damaging 1.00
R7187:Cacng7 UTSW 7 3336667 missense probably damaging 1.00
R8086:Cacng7 UTSW 7 3339002 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGGATACTGACTGTGCTTTGCCAC -3'
(R):5'- GCTAGGTGCAAGATACCACCAGAAG -3'

Sequencing Primer
(F):5'- GTGTACTTGTTCACCAAGCG -3'
(R):5'- TACCACCAGAAGATAGTAAACTCGG -3'
Posted On2014-01-05