Mutagenetix > Incidental Mutations

Incidental Mutation 'R1122:Pdzd2'

95767

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

039195-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R1122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12457895 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 294 (V294A)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000186113] [ENSMUST00000189324] [ENSMUST00000190929]

Predicted Effect

probably benign
Transcript: ENSMUST00000075317
AA Change: V294A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V294A

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186113

Predicted Effect

probably benign
Transcript: ENSMUST00000189324

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189469

Predicted Effect

probably benign
Transcript: ENSMUST00000190929
AA Change: V120A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197
AA Change: V120A

Domain	Start	End	E-Value	Type
PDZ	168	245	3e-20	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	G	A	11: 70,011,377	L469F	probably damaging	Het
Adgrb1	C	A	15: 74,547,685	R792S	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap15	A	T	2: 44,142,295	H297L	probably benign	Het
BC003965	T	C	17: 25,184,872	I62T	probably benign	Het
Chtf18	T	C	17: 25,724,623	E333G	probably damaging	Het
Cyb5a	A	G	18: 84,877,839	T77A	possibly damaging	Het
Exosc10	T	C	4: 148,566,364	W456R	possibly damaging	Het
Fam160b1	A	T	19: 57,382,301	T551S	probably benign	Het
Fam189a2	T	C	19: 23,975,392	E518G	probably damaging	Het
Gad2	A	T	2: 22,623,451	Q31L	possibly damaging	Het
Gm9637	T	A	14: 19,401,879		noncoding transcript	Het
Itgav	A	G	2: 83,791,939	T622A	probably benign	Het
Kifc5b	T	A	17: 26,924,061	V269E	probably benign	Het
Lrrc15	T	C	16: 30,273,901	N207D	probably damaging	Het
Map2k5	A	G	9: 63,263,163	V291A	probably damaging	Het
Mrc1	G	A	2: 14,261,336		probably null	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Olfr101	T	A	17: 37,300,128	Q98L	probably damaging	Het
Olfr97	T	A	17: 37,232,043	D109V	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rnf220	C	T	4: 117,278,080	G171S	probably benign	Het
Slc6a4	T	C	11: 77,027,186	S585P	possibly damaging	Het
Slc7a8	T	C	14: 54,724,107	E528G	probably benign	Het
Slco4c1	A	G	1: 96,828,836	I587T	possibly damaging	Het
Syt4	T	A	18: 31,440,202	H420L	probably damaging	Het
Tec	T	C	5: 72,779,449	K236E	probably damaging	Het
Ttn	A	G	2: 76,715,332	V32549A	probably damaging	Het
Wdfy3	T	C	5: 101,882,966	H2299R	possibly damaging	Het
Zfp729b	A	G	13: 67,595,284	V64A	possibly damaging	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTTTGTTGGCTTCAAAGCACAAGG -3'
(R):5'- AGTGGTTGTGACACCGCAGATG -3'

Sequencing Primer
(F):5'- cagacacacaaacagacagac -3'
(R):5'- AGATGATCCCAGCTCGGAG -3'

Posted On

2014-01-05