Incidental Mutation 'R1122:Chtf18'
ID95780
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission 039195-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R1122 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25724623 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 333 (E333G)
Ref Sequence ENSEMBL: ENSMUSP00000131366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047273] [ENSMUST00000048054] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575]
Predicted Effect probably benign
Transcript: ENSMUST00000047273
SMART Domains Protein: ENSMUSP00000043825
Gene: ENSMUSG00000041199

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 17 182 4.1e-27 PFAM
low complexity region 271 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048054
AA Change: E332G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: E332G

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170575
AA Change: E333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214
AA Change: E333G

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl G A 11: 70,011,377 L469F probably damaging Het
Adgrb1 C A 15: 74,547,685 R792S probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap15 A T 2: 44,142,295 H297L probably benign Het
BC003965 T C 17: 25,184,872 I62T probably benign Het
Cyb5a A G 18: 84,877,839 T77A possibly damaging Het
Exosc10 T C 4: 148,566,364 W456R possibly damaging Het
Fam160b1 A T 19: 57,382,301 T551S probably benign Het
Fam189a2 T C 19: 23,975,392 E518G probably damaging Het
Gad2 A T 2: 22,623,451 Q31L possibly damaging Het
Gm9637 T A 14: 19,401,879 noncoding transcript Het
Itgav A G 2: 83,791,939 T622A probably benign Het
Kifc5b T A 17: 26,924,061 V269E probably benign Het
Lrrc15 T C 16: 30,273,901 N207D probably damaging Het
Map2k5 A G 9: 63,263,163 V291A probably damaging Het
Mrc1 G A 2: 14,261,336 probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr101 T A 17: 37,300,128 Q98L probably damaging Het
Olfr97 T A 17: 37,232,043 D109V probably damaging Het
Pdzd2 A G 15: 12,457,895 V294A probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnf220 C T 4: 117,278,080 G171S probably benign Het
Slc6a4 T C 11: 77,027,186 S585P possibly damaging Het
Slc7a8 T C 14: 54,724,107 E528G probably benign Het
Slco4c1 A G 1: 96,828,836 I587T possibly damaging Het
Syt4 T A 18: 31,440,202 H420L probably damaging Het
Tec T C 5: 72,779,449 K236E probably damaging Het
Ttn A G 2: 76,715,332 V32549A probably damaging Het
Wdfy3 T C 5: 101,882,966 H2299R possibly damaging Het
Zfp729b A G 13: 67,595,284 V64A possibly damaging Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 splice site probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R7939:Chtf18 UTSW 17 25722137 missense probably damaging 0.99
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CACTCAGTAGGAGAAAACCCTGTGC -3'
(R):5'- CCTCAGTGTTGCCGTCTGTGTTAAAAG -3'

Sequencing Primer
(F):5'- ACTTGATGCCAACCCTGATG -3'
(R):5'- TCAAGTGGCTGAAGCTATGG -3'
Posted On2014-01-05