Incidental Mutation 'R1122:Fam189a2'
ID95798
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission 039195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1122 (G1)
Quality Score220
Status Not validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23975392 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 518 (E518G)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably damaging
Transcript: ENSMUST00000096164
AA Change: E518G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: E518G

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl G A 11: 70,011,377 L469F probably damaging Het
Adgrb1 C A 15: 74,547,685 R792S probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap15 A T 2: 44,142,295 H297L probably benign Het
BC003965 T C 17: 25,184,872 I62T probably benign Het
Chtf18 T C 17: 25,724,623 E333G probably damaging Het
Cyb5a A G 18: 84,877,839 T77A possibly damaging Het
Exosc10 T C 4: 148,566,364 W456R possibly damaging Het
Fam160b1 A T 19: 57,382,301 T551S probably benign Het
Gad2 A T 2: 22,623,451 Q31L possibly damaging Het
Gm9637 T A 14: 19,401,879 noncoding transcript Het
Itgav A G 2: 83,791,939 T622A probably benign Het
Kifc5b T A 17: 26,924,061 V269E probably benign Het
Lrrc15 T C 16: 30,273,901 N207D probably damaging Het
Map2k5 A G 9: 63,263,163 V291A probably damaging Het
Mrc1 G A 2: 14,261,336 probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr101 T A 17: 37,300,128 Q98L probably damaging Het
Olfr97 T A 17: 37,232,043 D109V probably damaging Het
Pdzd2 A G 15: 12,457,895 V294A probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnf220 C T 4: 117,278,080 G171S probably benign Het
Slc6a4 T C 11: 77,027,186 S585P possibly damaging Het
Slc7a8 T C 14: 54,724,107 E528G probably benign Het
Slco4c1 A G 1: 96,828,836 I587T possibly damaging Het
Syt4 T A 18: 31,440,202 H420L probably damaging Het
Tec T C 5: 72,779,449 K236E probably damaging Het
Ttn A G 2: 76,715,332 V32549A probably damaging Het
Wdfy3 T C 5: 101,882,966 H2299R possibly damaging Het
Zfp729b A G 13: 67,595,284 V64A possibly damaging Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCTGCCATCATTTTCAAGAGCCG -3'
(R):5'- AGGCTAGATCTCGCTACAGTGACTC -3'

Sequencing Primer
(F):5'- AGAAAGTGAGGTTCTCTTCCC -3'
(R):5'- TCGCTACAGTGACTCTGAGG -3'
Posted On2014-01-05