Incidental Mutation 'R1006:Olfr1449'
ID95813
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission 039116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1006 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12935274 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 179 (C179S)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect probably damaging
Transcript: ENSMUST00000056005
AA Change: C179S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: C179S

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208624
AA Change: C179S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214079
AA Change: C179S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215325
AA Change: C179S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8033 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,458,441 I282N probably benign Het
Akr1c18 T C 13: 4,136,655 I265V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arfgef1 T C 1: 10,140,481 I1788V probably benign Het
Cacng7 T A 7: 3,366,929 I270N possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cnbd2 A G 2: 156,328,408 I138V possibly damaging Het
Cntnap5b A G 1: 100,383,617 K983E probably benign Het
Col14a1 T C 15: 55,519,935 S1770P probably benign Het
Cpsf6 A T 10: 117,366,068 probably benign Het
Ctsc G A 7: 88,309,829 R439H probably damaging Het
Dcun1d1 A G 3: 35,897,781 probably benign Het
Flg2 A G 3: 93,201,207 I181V probably benign Het
Gbp2 A T 3: 142,637,422 S567C probably damaging Het
Gm5114 A G 7: 39,409,086 S370P probably damaging Het
Kcnh7 A G 2: 62,716,183 V1018A probably benign Het
Kmt2a G A 9: 44,847,696 A952V probably damaging Het
Krt1 C T 15: 101,847,891 E340K possibly damaging Het
Lim2 T A 7: 43,435,402 I141N probably damaging Het
Nlrp4a T C 7: 26,453,467 V654A probably benign Het
Prr14l T C 5: 32,829,482 S890G probably benign Het
Psmd14 T A 2: 61,797,382 probably null Het
Ptpn13 A G 5: 103,586,789 D2129G probably benign Het
Pum1 C T 4: 130,771,888 T760M probably damaging Het
Rif1 A G 2: 52,085,029 I317V probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slfn8 A T 11: 83,003,511 H767Q possibly damaging Het
Sned1 G A 1: 93,256,392 G114D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tenm3 A T 8: 48,228,542 D2684E probably damaging Het
Tet2 T C 3: 133,476,601 T1201A possibly damaging Het
Vax2 T C 6: 83,737,777 S225P probably damaging Het
Vcan A G 13: 89,685,077 probably null Het
Washc5 T A 15: 59,369,186 Q100L probably benign Het
Washc5 G T 15: 59,369,187 Q100K probably benign Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zmiz1 A G 14: 25,662,980 Y1051C unknown Het
Zswim2 G A 2: 83,915,393 S567L probably damaging Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0588:Olfr1449 UTSW 19 12934747 missense probably benign 0.00
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2355:Olfr1449 UTSW 19 12935019 missense possibly damaging 0.91
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4673:Olfr1449 UTSW 19 12935097 missense probably damaging 1.00
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R5958:Olfr1449 UTSW 19 12935047 missense probably damaging 1.00
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6695:Olfr1449 UTSW 19 12935400 missense possibly damaging 0.95
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTGTGCAAGCCCTTACATTACACC -3'
(R):5'- AAAACAGATGCCATTTGGTCATTGTCC -3'

Sequencing Primer
(F):5'- TTACACCACAACTATGACTACCAGTG -3'
(R):5'- CTGGGCTGTAGGTACATGAAGATTAC -3'
Posted On2014-01-05