Incidental Mutation 'R1123:Cel'
ID95816
Institutional Source Beutler Lab
Gene Symbol Cel
Ensembl Gene ENSMUSG00000026818
Gene Namecarboxyl ester lipase
Synonyms1810036E18Rik, BAL
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28555795-28563403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28556740 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 473 (Y473C)
Ref Sequence ENSEMBL: ENSMUSP00000028161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028161] [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000140704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028161
AA Change: Y473C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818
AA Change: Y473C

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028170
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100241
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113893
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably benign
Transcript: ENSMUST00000140704
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced cholesteryl ester absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Cel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Cel APN 2 28559385 missense probably damaging 0.98
IGL01327:Cel APN 2 28557955 missense possibly damaging 0.61
IGL01606:Cel APN 2 28560564 missense probably benign 0.04
R0304:Cel UTSW 2 28557771 missense probably benign 0.04
R0321:Cel UTSW 2 28561148 missense probably benign 0.00
R0865:Cel UTSW 2 28560615 missense probably damaging 1.00
R1424:Cel UTSW 2 28559624 missense probably damaging 0.99
R1448:Cel UTSW 2 28556326 missense probably damaging 1.00
R1597:Cel UTSW 2 28560467 splice site probably benign
R1717:Cel UTSW 2 28556777 missense probably damaging 1.00
R2256:Cel UTSW 2 28561192 missense probably damaging 1.00
R3149:Cel UTSW 2 28556131 missense probably benign 0.04
R4105:Cel UTSW 2 28558027 missense probably benign 0.35
R4520:Cel UTSW 2 28557968 missense probably benign 0.08
R5135:Cel UTSW 2 28559423 missense probably benign 0.39
R5318:Cel UTSW 2 28557708 missense possibly damaging 0.77
R5323:Cel UTSW 2 28560518 missense probably damaging 1.00
R5958:Cel UTSW 2 28560945 missense probably damaging 0.97
R6803:Cel UTSW 2 28558048 missense probably benign 0.36
R6976:Cel UTSW 2 28556842 missense probably damaging 1.00
R7342:Cel UTSW 2 28560637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGGCTCAGTCATGGTGAGCAC -3'
(R):5'- ATGCCTCTACTTCCCTTAGGAGCG -3'

Sequencing Primer
(F):5'- CTAGCTACCAAGGCTTGAGG -3'
(R):5'- TTAGGAGCGCCAAGACCTATTC -3'
Posted On2014-01-05