Incidental Mutation 'R1123:Olfr1154'
ID95824
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87902904 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 257 (I257M)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: I257M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: I257M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: I257M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: I257M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000217436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
R8099:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R8168:Olfr1154 UTSW 2 87903199 missense probably damaging 0.97
R8917:Olfr1154 UTSW 2 87902963 missense possibly damaging 0.81
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTAAAGTTGTGAAGCCCATCTTTACT -3'
(R):5'- GTACTCACCTGGCATTTGGAGCATT -3'

Sequencing Primer
(F):5'- GACGTCTTTGTTCCTGAGACT -3'
(R):5'- TTGCACTGATACCTATACACATGAC -3'
Posted On2014-01-05