Incidental Mutation 'R1123:Suclg1'
ID95848
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73256227 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 51 (I51V)
Ref Sequence ENSEMBL: ENSMUSP00000145246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000123159] [ENSMUST00000203632]
Predicted Effect probably benign
Transcript: ENSMUST00000064740
AA Change: I52V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: I52V

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173409
Predicted Effect probably benign
Transcript: ENSMUST00000203632
AA Change: I51V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738
AA Change: I51V

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 intron probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGTTCCTTTGTGGGGAATGA -3'
(R):5'- CGCAATGTCCATTTTACAATGTCCACC -3'

Sequencing Primer
(F):5'- cacccgactgctcttcc -3'
(R):5'- ATTTTACAATGTCCACCTGCAC -3'
Posted On2014-01-05