Incidental Mutation 'R1123:Lrfn1'
ID95852
Institutional Source Beutler Lab
Gene Symbol Lrfn1
Ensembl Gene ENSMUSG00000030600
Gene Nameleucine rich repeat and fibronectin type III domain containing 1
SynonymsSALM2
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28451980-28468242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28467119 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 646 (C646F)
Ref Sequence ENSEMBL: ENSMUSP00000103923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000108288] [ENSMUST00000189877]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108288
AA Change: C646F

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103923
Gene: ENSMUSG00000030600
AA Change: C646F

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
FN3 422 502 2.68e-2 SMART
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 730 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189877
SMART Domains Protein: ENSMUSP00000139609
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Lrfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Lrfn1 APN 7 28460017 missense probably damaging 1.00
IGL01565:Lrfn1 APN 7 28458769 missense probably damaging 1.00
IGL01622:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL01623:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL02176:Lrfn1 APN 7 28458686 intron probably benign
IGL02642:Lrfn1 APN 7 28458688 intron probably benign
R1838:Lrfn1 UTSW 7 28459768 missense probably damaging 0.98
R3000:Lrfn1 UTSW 7 28467407 missense probably damaging 1.00
R3551:Lrfn1 UTSW 7 28460054 missense possibly damaging 0.90
R3905:Lrfn1 UTSW 7 28466869 missense possibly damaging 0.49
R4246:Lrfn1 UTSW 7 28459942 missense probably benign 0.03
R5621:Lrfn1 UTSW 7 28466836 missense probably damaging 1.00
R6267:Lrfn1 UTSW 7 28459744 missense probably benign 0.01
R6902:Lrfn1 UTSW 7 28459813 missense probably benign 0.10
R7059:Lrfn1 UTSW 7 28466930 missense possibly damaging 0.65
R7073:Lrfn1 UTSW 7 28459972 missense possibly damaging 0.94
R7208:Lrfn1 UTSW 7 28467139 missense probably benign
R7402:Lrfn1 UTSW 7 28459522 missense probably damaging 1.00
R8378:Lrfn1 UTSW 7 28459732 missense probably benign 0.26
Z1176:Lrfn1 UTSW 7 28459115 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGCCAGACCTTCCTAGTGAATGACC -3'
(R):5'- TAACTGTGACTCTGGAACAGCGCC -3'

Sequencing Primer
(F):5'- GCTCATGATTCGCTACAAGG -3'
(R):5'- AACAGCGCCCCGTAGTC -3'
Posted On2014-01-05