Incidental Mutation 'R1013:Lck'
ID95854
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Namelymphocyte protein tyrosine kinase
SynonymsHck-3, p56
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129548344-129573641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129558127 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 20 (C20Y)
Ref Sequence ENSEMBL: ENSMUSP00000119263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]
Predicted Effect probably damaging
Transcript: ENSMUST00000067240
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102596
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably damaging
Transcript: ENSMUST00000134336
AA Change: C20Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139957
Predicted Effect probably damaging
Transcript: ENSMUST00000167288
AA Change: C31Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: C31Y

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183371
Meta Mutation Damage Score 0.9413 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense probably damaging 0.98
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5706:Lck UTSW 4 129551638 critical splice acceptor site probably null
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGTGCTGCTATTTTCCAGAGCC -3'
(R):5'- GGAACCCAGTCAGGAGCTTGAATC -3'

Sequencing Primer
(F):5'- CCAGAGCCTTTAGTTATGGTCC -3'
(R):5'- TCAGGAGCTTGAATCCCACG -3'
Posted On2014-01-05