Incidental Mutation 'R1013:Lck'
ID 95854
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Name lymphocyte protein tyrosine kinase
Synonyms Hck-3, p56
MMRRC Submission 039117-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1013 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 129442142-129467415 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 129451920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 20 (C20Y)
Ref Sequence ENSEMBL: ENSMUSP00000119263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]
AlphaFold P06240
Predicted Effect probably damaging
Transcript: ENSMUST00000067240
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102596
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably damaging
Transcript: ENSMUST00000134336
AA Change: C20Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409
AA Change: C20Y

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000167288
AA Change: C31Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: C31Y

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183371
Meta Mutation Damage Score 0.9413 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 (GRCm38) noncoding transcript Het
Bclaf1 T A 10: 20,207,822 (GRCm39) probably benign Het
Bicdl2 A G 17: 23,884,377 (GRCm39) probably benign Het
C8a T C 4: 104,685,236 (GRCm39) I336V probably benign Het
Calcr A T 6: 3,692,621 (GRCm39) V374D probably damaging Het
Col28a1 A G 6: 7,999,452 (GRCm39) probably benign Het
Cuedc1 C T 11: 88,078,853 (GRCm39) A327V possibly damaging Het
Cul2 C A 18: 3,425,535 (GRCm39) Y378* probably null Het
Dnaaf10 A G 11: 17,178,183 (GRCm39) K226E probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Gm8369 TG TGNG 19: 11,489,147 (GRCm39) probably null Het
Hivep1 A G 13: 42,310,438 (GRCm39) R893G probably damaging Het
Il10rb A G 16: 91,211,581 (GRCm39) N140D probably benign Het
Itga4 A G 2: 79,150,847 (GRCm39) M818V probably benign Het
Kyat3 T C 3: 142,432,007 (GRCm39) I245T probably damaging Het
Mcm6 T G 1: 128,276,778 (GRCm39) S271R probably benign Het
Megf10 A G 18: 57,394,291 (GRCm39) I472V probably benign Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mrpl11 T C 19: 5,013,651 (GRCm39) I144T possibly damaging Het
Or2t26 G A 11: 49,039,977 (GRCm39) V298M probably damaging Het
Or8k25 G A 2: 86,244,319 (GRCm39) P26S possibly damaging Het
Pcdhb17 A G 18: 37,619,020 (GRCm39) D270G probably damaging Het
Plg G A 17: 12,597,608 (GRCm39) probably benign Het
Ppp3cb T A 14: 20,574,072 (GRCm39) E255D probably benign Het
Psenen A G 7: 30,261,802 (GRCm39) F38S possibly damaging Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Sorl1 T C 9: 41,913,855 (GRCm39) N1358S probably benign Het
Trim3 G A 7: 105,267,102 (GRCm39) P426S probably benign Het
Ttc28 T C 5: 111,424,831 (GRCm39) M1552T probably benign Het
Unc13c T C 9: 73,840,614 (GRCm39) D79G probably benign Het
Zcchc14 A G 8: 122,333,664 (GRCm39) probably benign Het
Zfp354a T C 11: 50,951,677 (GRCm39) probably benign Het
Zfp729a T C 13: 67,767,626 (GRCm39) I868V probably benign Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129,451,939 (GRCm39) missense probably benign 0.00
IGL02666:Lck APN 4 129,450,212 (GRCm39) missense probably damaging 0.98
iconoclast UTSW 4 129,449,397 (GRCm39) missense probably damaging 1.00
lockdown UTSW 4 129,451,920 (GRCm39) missense probably damaging 1.00
stromberg UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
studentenkarzer UTSW 4 129,450,098 (GRCm39) missense probably damaging 1.00
swan UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
R0091:Lck UTSW 4 129,449,474 (GRCm39) missense possibly damaging 0.88
R0480:Lck UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
R1510:Lck UTSW 4 129,449,461 (GRCm39) missense possibly damaging 0.92
R1569:Lck UTSW 4 129,449,449 (GRCm39) missense probably damaging 0.98
R1845:Lck UTSW 4 129,451,879 (GRCm39) missense probably benign 0.00
R2001:Lck UTSW 4 129,442,730 (GRCm39) missense probably benign 0.00
R2141:Lck UTSW 4 129,442,713 (GRCm39) missense probably damaging 1.00
R4694:Lck UTSW 4 129,442,765 (GRCm39) missense possibly damaging 0.66
R4737:Lck UTSW 4 129,449,777 (GRCm39) missense possibly damaging 0.93
R5706:Lck UTSW 4 129,445,431 (GRCm39) critical splice acceptor site probably null
R5712:Lck UTSW 4 129,450,103 (GRCm39) missense probably benign
R7023:Lck UTSW 4 129,442,658 (GRCm39) missense possibly damaging 0.89
R7411:Lck UTSW 4 129,445,763 (GRCm39) missense probably benign 0.02
R9044:Lck UTSW 4 129,450,098 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTGCTGCTATTTTCCAGAGCC -3'
(R):5'- GGAACCCAGTCAGGAGCTTGAATC -3'

Sequencing Primer
(F):5'- CCAGAGCCTTTAGTTATGGTCC -3'
(R):5'- TCAGGAGCTTGAATCCCACG -3'
Posted On 2014-01-05