Mutagenetix > Incidental Mutation

Incidental Mutation 'R1013:Lck'

95854

Institutional Source

Beutler Lab

Gene Symbol

Lck

Ensembl Gene

ENSMUSG00000000409

Gene Name

lymphocyte protein tyrosine kinase

Synonyms

Hck-3, p56

MMRRC Submission

039117-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1013 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129548344-129573641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 129558127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 20 (C20Y)

Ref Sequence

ENSEMBL: ENSMUSP00000119263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]

AlphaFold

P06240

Predicted Effect

probably damaging
Transcript: ENSMUST00000067240
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: C20Y

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102596
AA Change: C20Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: C20Y

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123640

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132030

Predicted Effect

probably damaging
Transcript: ENSMUST00000134336
AA Change: C20Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409
AA Change: C20Y

Domain	Start	End	E-Value	Type
PDB:1Q69\|B	7	33	9e-12	PDB
SCOP:d1awj__	45	92	2e-8	SMART
PDB:1LCK\|A	53	92	3e-20	PDB
Blast:SH3	64	92	4e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139957

Predicted Effect

probably damaging
Transcript: ENSMUST00000167288
AA Change: C31Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: C31Y

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183371

Meta Mutation Damage Score

0.9413

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.4%

Validation Efficiency

98% (39/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
4930527J03Rik	ACCC	ACC	1: 178,276,503		noncoding transcript	Het
Bclaf1	T	A	10: 20,332,076		probably benign	Het
Bicdl2	A	G	17: 23,665,403		probably benign	Het
C8a	T	C	4: 104,828,039	I336V	probably benign	Het
Calcr	A	T	6: 3,692,621	V374D	probably damaging	Het
Col28a1	A	G	6: 7,999,452		probably benign	Het
Cuedc1	C	T	11: 88,188,027	A327V	possibly damaging	Het
Cul2	C	A	18: 3,425,535	Y378*	probably null	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Gm8369	TG	TGNG	19: 11,511,783		probably null	Het
Hivep1	A	G	13: 42,156,962	R893G	probably damaging	Het
Il10rb	A	G	16: 91,414,693	N140D	probably benign	Het
Itga4	A	G	2: 79,320,503	M818V	probably benign	Het
Kyat3	T	C	3: 142,726,246	I245T	probably damaging	Het
Mcm6	T	G	1: 128,349,041	S271R	probably benign	Het
Megf10	A	G	18: 57,261,219	I472V	probably benign	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mrpl11	T	C	19: 4,963,623	I144T	possibly damaging	Het
Olfr1061	G	A	2: 86,413,975	P26S	possibly damaging	Het
Olfr1395	G	A	11: 49,149,150	V298M	probably damaging	Het
Pcdhb17	A	G	18: 37,485,967	D270G	probably damaging	Het
Plg	G	A	17: 12,378,721		probably benign	Het
Ppp3cb	T	A	14: 20,524,004	E255D	probably benign	Het
Psenen	A	G	7: 30,562,377	F38S	possibly damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Sorl1	T	C	9: 42,002,559	N1358S	probably benign	Het
Trim3	G	A	7: 105,617,895	P426S	probably benign	Het
Ttc28	T	C	5: 111,276,965	M1552T	probably benign	Het
Unc13c	T	C	9: 73,933,332	D79G	probably benign	Het
Wdr92	A	G	11: 17,228,183	K226E	probably damaging	Het
Zcchc14	A	G	8: 121,606,925		probably benign	Het
Zfp354a	T	C	11: 51,060,850		probably benign	Het
Zfp729a	T	C	13: 67,619,507	I868V	probably benign	Het

Other mutations in Lck

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01824:Lck	APN	4	129558146	missense	probably benign	0.00
IGL02666:Lck	APN	4	129556419	missense	probably damaging	0.98
iconoclast	UTSW	4	129555604	missense	probably damaging	1.00
lockdown	UTSW	4	129558127	missense	probably damaging	1.00
stromberg	UTSW	4	129555640	missense	probably damaging	1.00
studentenkarzer	UTSW	4	129556305	missense	probably damaging	1.00
swan	UTSW	4	129555640	missense	probably damaging	1.00
R0091:Lck	UTSW	4	129555681	missense	possibly damaging	0.88
R0480:Lck	UTSW	4	129555640	missense	probably damaging	1.00
R1510:Lck	UTSW	4	129555668	missense	possibly damaging	0.92
R1569:Lck	UTSW	4	129555656	missense	probably damaging	0.98
R1845:Lck	UTSW	4	129558086	missense	probably benign	0.00
R2001:Lck	UTSW	4	129548937	missense	probably benign	0.00
R2141:Lck	UTSW	4	129548920	missense	probably damaging	1.00
R4694:Lck	UTSW	4	129548972	missense	possibly damaging	0.66
R4737:Lck	UTSW	4	129555984	missense	possibly damaging	0.93
R5706:Lck	UTSW	4	129551638	critical splice acceptor site	probably null
R5712:Lck	UTSW	4	129556310	missense	probably benign
R7023:Lck	UTSW	4	129548865	missense	possibly damaging	0.89
R7411:Lck	UTSW	4	129551970	missense	probably benign	0.02
R9044:Lck	UTSW	4	129556305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTGCTGCTATTTTCCAGAGCC -3'
(R):5'- GGAACCCAGTCAGGAGCTTGAATC -3'

Sequencing Primer
(F):5'- CCAGAGCCTTTAGTTATGGTCC -3'
(R):5'- TCAGGAGCTTGAATCCCACG -3'

Posted On

2014-01-05