Incidental Mutation 'R1013:Calcr'
ID95864
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3692621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 374 (V374D)
Ref Sequence ENSEMBL: ENSMUSP00000130083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect probably damaging
Transcript: ENSMUST00000075644
AA Change: V411D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964
AA Change: V411D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115622
AA Change: V374D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964
AA Change: V374D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168592
AA Change: V374D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964
AA Change: V374D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170266
AA Change: V411D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964
AA Change: V411D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171613
AA Change: V374D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964
AA Change: V374D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R0561:Calcr UTSW 6 3692630 missense probably damaging 0.99
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4403:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5688:Calcr UTSW 6 3714730 synonymous probably null
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6249:Calcr UTSW 6 3692711 missense possibly damaging 0.49
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 1.00
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
R7034:Calcr UTSW 6 3692543 missense probably damaging 1.00
R7208:Calcr UTSW 6 3687612 missense probably benign 0.00
R7342:Calcr UTSW 6 3691536 missense probably benign 0.03
R7430:Calcr UTSW 6 3708586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTAAAGGGGCCTGTGTATC -3'
(R):5'- AAAAGTCACTCGCTTGCTTGCTTTC -3'

Sequencing Primer
(F):5'- GAAGGCTATGCATTTTGACTCC -3'
(R):5'- GTGCTTGTGACCAAGATGAG -3'
Posted On2014-01-05