Incidental Mutation 'R1123:Slc35g2'
ID95865
Institutional Source Beutler Lab
Gene Symbol Slc35g2
Ensembl Gene ENSMUSG00000070287
Gene Namesolute carrier family 35, member G2
SynonymsLOC245020, Tmem22
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location100552188-100571090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100552994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 208 (I208N)
Ref Sequence ENSEMBL: ENSMUSP00000091308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093792]
Predicted Effect probably damaging
Transcript: ENSMUST00000093792
AA Change: I208N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091308
Gene: ENSMUSG00000070287
AA Change: I208N

DomainStartEndE-ValueType
Pfam:EamA 102 238 3.8e-12 PFAM
Pfam:EamA 255 390 5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189478
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Slc35g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Slc35g2 APN 9 100552463 missense probably damaging 1.00
IGL03264:Slc35g2 APN 9 100552646 missense possibly damaging 0.93
R0127:Slc35g2 UTSW 9 100553117 missense probably benign 0.12
R0626:Slc35g2 UTSW 9 100553442 missense probably benign 0.00
R2012:Slc35g2 UTSW 9 100553067 missense possibly damaging 0.88
R2057:Slc35g2 UTSW 9 100553276 missense probably damaging 1.00
R3922:Slc35g2 UTSW 9 100552727 missense probably benign 0.20
R3924:Slc35g2 UTSW 9 100552727 missense probably benign 0.20
R4561:Slc35g2 UTSW 9 100553234 missense probably damaging 1.00
R4731:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4732:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4733:Slc35g2 UTSW 9 100552502 missense probably benign 0.20
R4760:Slc35g2 UTSW 9 100553496 missense probably benign 0.22
R8310:Slc35g2 UTSW 9 100552788 missense probably damaging 1.00
R8420:Slc35g2 UTSW 9 100553171 missense probably benign
X0020:Slc35g2 UTSW 9 100553016 missense probably benign 0.30
Z1176:Slc35g2 UTSW 9 100552529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATACCCGAAGGCTTCCTTCCAG -3'
(R):5'- CTCATCACGAGGCTCATTTCCGAC -3'

Sequencing Primer
(F):5'- CCTTCCAGGCGTTTAACAGAG -3'
(R):5'- AGAACTGATTTTTATCCGGTCTGTC -3'
Posted On2014-01-05