Incidental Mutation 'R1123:Esyt1'
ID95877
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Nameextended synaptotagmin-like protein 1
Synonymsvp115, Mbc2, Fam62a
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128509965-128525871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128516558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 728 (V728E)
Ref Sequence ENSEMBL: ENSMUSP00000026427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
Predicted Effect probably benign
Transcript: ENSMUST00000026427
AA Change: V728E

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366
AA Change: V728E

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220045
Predicted Effect unknown
Transcript: ENSMUST00000220429
AA Change: V334E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128517635 missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128521874 missense probably benign 0.00
IGL00534:Esyt1 APN 10 128515684 critical splice donor site probably null
IGL00578:Esyt1 APN 10 128511743 missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128517063 missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128519791 missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128518941 missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128511494 missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128522312 missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128512367 missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128512424 missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128522093 missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128511008 missense probably benign
IGL02948:Esyt1 APN 10 128519171 missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128516757 missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128516383 missense probably benign 0.00
R0039:Esyt1 UTSW 10 128520962 missense probably damaging 0.99
R0285:Esyt1 UTSW 10 128512218 missense possibly damaging 0.50
R0453:Esyt1 UTSW 10 128512209 missense probably benign 0.00
R1496:Esyt1 UTSW 10 128512428 missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128518994 missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128525534 missense probably benign 0.01
R1813:Esyt1 UTSW 10 128519618 missense probably benign
R1827:Esyt1 UTSW 10 128516369 missense probably benign 0.01
R2038:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2039:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2115:Esyt1 UTSW 10 128522104 missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128517045 missense probably damaging 1.00
R3919:Esyt1 UTSW 10 128521036 unclassified probably benign
R3980:Esyt1 UTSW 10 128511524 missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128516574 missense probably benign 0.00
R5534:Esyt1 UTSW 10 128519460 missense probably benign 0.07
R5704:Esyt1 UTSW 10 128511510 missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128511902 missense probably benign 0.01
R6431:Esyt1 UTSW 10 128516674 critical splice donor site probably null
R7013:Esyt1 UTSW 10 128525651 missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128516236 missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128515760 missense possibly damaging 0.79
R7570:Esyt1 UTSW 10 128518932 missense possibly damaging 0.52
R7700:Esyt1 UTSW 10 128515854 splice site probably benign
R7732:Esyt1 UTSW 10 128521825 critical splice donor site probably null
R8009:Esyt1 UTSW 10 128511485 missense probably benign 0.01
R8049:Esyt1 UTSW 10 128512086 missense probably benign
R8222:Esyt1 UTSW 10 128511778 missense possibly damaging 0.77
R8365:Esyt1 UTSW 10 128516553 missense possibly damaging 0.89
R8366:Esyt1 UTSW 10 128516553 missense possibly damaging 0.89
R8407:Esyt1 UTSW 10 128511927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGTGGACGCTGACAAGAGG -3'
(R):5'- TGCCCCAACAGTGACTGCTATTC -3'

Sequencing Primer
(F):5'- TCTAACTCAGCAGCAGTCGG -3'
(R):5'- GTGATTGTCACATCAATCCCTGG -3'
Posted On2014-01-05