Incidental Mutation 'R1123:Ccdc122'
ID95889
Institutional Source Beutler Lab
Gene Symbol Ccdc122
Ensembl Gene ENSMUSG00000034795
Gene Namecoiled-coil domain containing 122
Synonyms4933415L06Rik
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location77036772-77112257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77067911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000093285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048208] [ENSMUST00000095625] [ENSMUST00000175810]
Predicted Effect probably damaging
Transcript: ENSMUST00000048208
AA Change: S2P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036369
Gene: ENSMUSG00000034795
AA Change: S2P

DomainStartEndE-ValueType
coiled coil region 33 102 N/A INTRINSIC
coiled coil region 152 182 N/A INTRINSIC
coiled coil region 209 279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095625
AA Change: S2P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093285
Gene: ENSMUSG00000034795
AA Change: S2P

DomainStartEndE-ValueType
coiled coil region 68 107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175810
AA Change: S2P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Ccdc122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ccdc122 APN 14 77091739 missense probably benign 0.02
IGL01307:Ccdc122 APN 14 77092076 splice site probably benign
IGL02585:Ccdc122 APN 14 77092762 splice site probably benign
IGL03376:Ccdc122 APN 14 77068912 missense probably damaging 1.00
R0724:Ccdc122 UTSW 14 77092077 splice site probably benign
R0732:Ccdc122 UTSW 14 77091759 missense probably damaging 0.99
R1528:Ccdc122 UTSW 14 77067939 missense possibly damaging 0.87
R1860:Ccdc122 UTSW 14 77111407 missense probably damaging 1.00
R2072:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2074:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2075:Ccdc122 UTSW 14 77068951 critical splice donor site probably null
R2421:Ccdc122 UTSW 14 77091663 splice site probably benign
R2442:Ccdc122 UTSW 14 77091958 missense possibly damaging 0.89
R4798:Ccdc122 UTSW 14 77111607 utr 3 prime probably benign
R4973:Ccdc122 UTSW 14 77067941 missense possibly damaging 0.92
R5487:Ccdc122 UTSW 14 77091679 missense probably benign 0.31
R5576:Ccdc122 UTSW 14 77091877 missense probably benign 0.24
R5630:Ccdc122 UTSW 14 77092776 missense probably damaging 1.00
R6502:Ccdc122 UTSW 14 77042069 splice site probably null
R6833:Ccdc122 UTSW 14 77088931 critical splice acceptor site probably benign
R7585:Ccdc122 UTSW 14 77091699 missense probably damaging 0.96
R7598:Ccdc122 UTSW 14 77111566 missense probably benign 0.00
R7774:Ccdc122 UTSW 14 77067939 missense probably benign 0.00
R8170:Ccdc122 UTSW 14 77091878 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTGCTTAGGATCAGGACCTGC -3'
(R):5'- ACATGAGCCCTCTGTGTGCTTATTC -3'

Sequencing Primer
(F):5'- tcgtttttctttccttcctaagtc -3'
(R):5'- TCTGATGAACTATGACTGTGTCC -3'
Posted On2014-01-05