Incidental Mutation 'R1123:Dtx3l'
ID95891
Institutional Source Beutler Lab
Gene Symbol Dtx3l
Ensembl Gene ENSMUSG00000049502
Gene Namedeltex 3-like, E3 ubiquitin ligase
Synonyms
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35926511-35939151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35933268 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 323 (A323T)
Ref Sequence ENSEMBL: ENSMUSP00000110535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]
Predicted Effect probably damaging
Transcript: ENSMUST00000081933
AA Change: A323T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502
AA Change: A323T

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114885
AA Change: A323T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: A323T

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Dtx3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Dtx3l APN 16 35931502 missense probably benign 0.10
IGL02255:Dtx3l APN 16 35933336 missense probably benign 0.10
R0560:Dtx3l UTSW 16 35932935 missense probably damaging 1.00
R1127:Dtx3l UTSW 16 35938757 missense possibly damaging 0.74
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1584:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1690:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1929:Dtx3l UTSW 16 35933689 missense possibly damaging 0.95
R2014:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2015:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2255:Dtx3l UTSW 16 35936579 missense probably benign 0.01
R3023:Dtx3l UTSW 16 35932436 missense probably benign 0.01
R3176:Dtx3l UTSW 16 35932173 missense probably benign 0.29
R5224:Dtx3l UTSW 16 35938793 missense possibly damaging 0.93
R5233:Dtx3l UTSW 16 35933238 missense possibly damaging 0.49
R5375:Dtx3l UTSW 16 35933027 missense probably damaging 1.00
R5884:Dtx3l UTSW 16 35932233 missense probably benign
R6821:Dtx3l UTSW 16 35933060 missense probably damaging 1.00
R6994:Dtx3l UTSW 16 35931372 critical splice donor site probably null
R7242:Dtx3l UTSW 16 35933401 missense possibly damaging 0.76
R7270:Dtx3l UTSW 16 35933657 missense probably damaging 1.00
R7837:Dtx3l UTSW 16 35931526 missense probably damaging 1.00
R7866:Dtx3l UTSW 16 35938750 missense probably benign 0.00
R8053:Dtx3l UTSW 16 35938952 unclassified probably benign
R8337:Dtx3l UTSW 16 35933703 missense probably benign 0.00
Z1176:Dtx3l UTSW 16 35932457 missense probably damaging 1.00
Z1176:Dtx3l UTSW 16 35933183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGAATCGACCTCGATGCCC -3'
(R):5'- TGTCTGCCCTCACATCATCAAAAGC -3'

Sequencing Primer
(F):5'- CGTCGTGTACCCAGATGC -3'
(R):5'- ATCACTTCTTGAGTGAGCAGC -3'
Posted On2014-01-05