Incidental Mutation 'R1123:Olfr180'
ID95893
Institutional Source Beutler Lab
Gene Symbol Olfr180
Ensembl Gene ENSMUSG00000090629
Gene Nameolfactory receptor 180
SynonymsMOR184-11P, GA_x54KRFPKG5P-55134972-55134019, Olfr1563-ps1, MOR184-9, MOR184-11P
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58914285-58929392 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58916334 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 102 (Y102*)
Ref Sequence ENSEMBL: ENSMUSP00000145601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171656] [ENSMUST00000205883] [ENSMUST00000206168]
Predicted Effect probably null
Transcript: ENSMUST00000171656
AA Change: Y102*
SMART Domains Protein: ENSMUSP00000128358
Gene: ENSMUSG00000090629
AA Change: Y102*

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-51 PFAM
Pfam:7tm_1 41 313 1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205883
AA Change: Y102*
Predicted Effect probably null
Transcript: ENSMUST00000206168
AA Change: Y102*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Olfr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr180 APN 16 58915850 missense probably benign 0.01
IGL01759:Olfr180 APN 16 58915928 missense probably damaging 0.99
IGL02499:Olfr180 APN 16 58916251 missense probably damaging 1.00
IGL02890:Olfr180 APN 16 58916374 missense probably benign 0.03
R1292:Olfr180 UTSW 16 58915771 missense probably damaging 1.00
R2983:Olfr180 UTSW 16 58916567 missense probably benign 0.00
R3894:Olfr180 UTSW 16 58916339 missense probably benign 0.28
R4176:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R4666:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R5058:Olfr180 UTSW 16 58916072 missense probably benign 0.00
R5375:Olfr180 UTSW 16 58915885 missense possibly damaging 0.83
R5998:Olfr180 UTSW 16 58916630 missense probably benign
R6225:Olfr180 UTSW 16 58916182 missense probably benign 0.32
R6315:Olfr180 UTSW 16 58916246 missense probably damaging 1.00
R6380:Olfr180 UTSW 16 58916264 missense probably damaging 1.00
R6866:Olfr180 UTSW 16 58915988 missense probably damaging 1.00
R7513:Olfr180 UTSW 16 58915932 missense probably damaging 1.00
R7582:Olfr180 UTSW 16 58916047 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CACCCTACATGAATCAAGGAATGCAGG -3'
(R):5'- TGGTGGGATTCTCAGATCACCCAGAC -3'

Sequencing Primer
(F):5'- CAAGGAATGCAGGTTACTGGTTATG -3'
(R):5'- AGACTTGAAGACACCTCTGTTC -3'
Posted On2014-01-05