Incidental Mutation 'R1013:Ppp3cb'
ID95909
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Nameprotein phosphatase 3, catalytic subunit, beta isoform
SynonymsCalnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20499364-20546573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20524004 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 255 (E255D)
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
Predicted Effect probably benign
Transcript: ENSMUST00000022355
AA Change: E255D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816
AA Change: E255D

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159027
AA Change: E255D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816
AA Change: E255D

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161332
Predicted Effect probably benign
Transcript: ENSMUST00000161445
AA Change: E255D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816
AA Change: E255D

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161989
AA Change: E255D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: E255D

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
eden_express UTSW 14 20528195 nonsense probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
Havana UTSW 14 20531752 missense possibly damaging 0.85
justinian UTSW 14 20508543 missense possibly damaging 0.73
prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 unclassified probably null
R1061:Ppp3cb UTSW 14 20508614 splice site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20515501 intron probably benign
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20523651 missense probably benign 0.00
R7493:Ppp3cb UTSW 14 20508551 missense probably benign 0.01
Z1177:Ppp3cb UTSW 14 20508518 missense unknown
Predicted Primers PCR Primer
(F):5'- GAATTCTTACCCTGCATCTTGAGCTTCA -3'
(R):5'- GGTGGACTTTCACCAGAAATACACACA -3'

Sequencing Primer
(F):5'- TTCACACACTGCTGGATAGC -3'
(R):5'- CTGATTCAAGGAAATAGCTCTTGGTG -3'
Posted On2014-01-05