Incidental Mutation 'R1013:Gm8369'
ID95934
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1013 (G1)
Quality Score123
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGNG at 11511783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably null
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191475
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGTGACAGTGATGGCATCTCC -3'
(R):5'- TGTCTGCTCCTGATCATGAGCAAC -3'

Sequencing Primer
(F):5'- TACAAGAACCACCTGGGAGA -3'
(R):5'- TTGGAGACCTCACTTCACTAACATAG -3'
Posted On2014-01-05