Incidental Mutation 'R1014:Col19a1'
ID95938
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 24301273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000051344] [ENSMUST00000115244] [ENSMUST00000115244]
Predicted Effect probably null
Transcript: ENSMUST00000051344
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051344
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115244
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115244
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144297
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
R7831:Col19a1 UTSW 1 24526482 missense unknown
R8252:Col19a1 UTSW 1 24279967 missense probably benign 0.05
R8728:Col19a1 UTSW 1 24326032 missense probably damaging 1.00
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACCATTGTAGAACCCGGAG -3'
(R):5'- GTGTCCCGCTCAATGAGGGAAAC -3'

Sequencing Primer
(F):5'- agctccaggaaatctagcac -3'
(R):5'- TGAGGGAAACGGCATGAGC -3'
Posted On2014-01-05