Incidental Mutation 'R1014:Wdr64'
ID95949
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene NameWD repeat domain 64
Synonyms4930511H01Rik, 4930415O10Rik
MMRRC Submission 039118-MU
Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175698593-175815734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175755626 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 376 (E376G)
Ref Sequence ENSEMBL: ENSMUSP00000141740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087]
Predicted Effect probably damaging
Transcript: ENSMUST00000094288
AA Change: E386G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: E386G

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171939
AA Change: E376G

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: E376G

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000194087
AA Change: E376G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: E376G

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175698800 missense probably benign 0.00
IGL00902:Wdr64 APN 1 175728825 missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175720333 missense probably benign 0.12
IGL01353:Wdr64 APN 1 175731585 missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175767156 critical splice donor site probably null
IGL01643:Wdr64 APN 1 175772311 missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175800356 missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175706071 missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175767047 nonsense probably null
IGL02834:Wdr64 APN 1 175805849 splice site probably benign
IGL03214:Wdr64 APN 1 175743635 splice site probably benign
IGL03305:Wdr64 APN 1 175755586 missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175766996 unclassified probably benign
PIT4418001:Wdr64 UTSW 1 175743594 nonsense probably null
R0036:Wdr64 UTSW 1 175728930 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0079:Wdr64 UTSW 1 175795102 missense probably benign 0.02
R0380:Wdr64 UTSW 1 175769642 splice site probably benign
R0486:Wdr64 UTSW 1 175795203 splice site probably benign
R0520:Wdr64 UTSW 1 175726392 missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175805899 missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175772185 missense probably benign 0.39
R0746:Wdr64 UTSW 1 175792973 missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175793081 missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175775749 missense probably benign
R1332:Wdr64 UTSW 1 175795140 missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175806002 missense probably benign 0.01
R1421:Wdr64 UTSW 1 175767150 missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1796:Wdr64 UTSW 1 175717331 missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175812019 missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175767095 missense probably benign 0.01
R2321:Wdr64 UTSW 1 175795087 missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175698913 missense probably benign
R4049:Wdr64 UTSW 1 175805856 missense probably benign 0.21
R4155:Wdr64 UTSW 1 175769606 missense probably benign 0.03
R4624:Wdr64 UTSW 1 175772263 missense probably benign
R4661:Wdr64 UTSW 1 175726494 missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175799229 missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175698779 unclassified probably benign
R4925:Wdr64 UTSW 1 175724702 splice site probably null
R4943:Wdr64 UTSW 1 175720316 missense probably benign 0.01
R5000:Wdr64 UTSW 1 175726375 splice site probably null
R5001:Wdr64 UTSW 1 175792959 critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175726413 missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175755598 missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175812057 missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175805990 missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175726390 missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175785609 critical splice donor site probably null
R6555:Wdr64 UTSW 1 175720290 missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175805928 missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175810610 critical splice donor site probably null
R6891:Wdr64 UTSW 1 175706068 missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175705989 missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175789933 missense probably benign 0.34
R7252:Wdr64 UTSW 1 175775674 missense probably benign 0.00
R7552:Wdr64 UTSW 1 175785581 missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175789929 missense probably benign
R7777:Wdr64 UTSW 1 175789998 missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175728976 missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175731526 missense probably benign 0.01
R7833:Wdr64 UTSW 1 175763945 missense probably damaging 1.00
R7843:Wdr64 UTSW 1 175812102 missense probably benign 0.00
R7887:Wdr64 UTSW 1 175785545 missense not run
R7991:Wdr64 UTSW 1 175726485 missense probably benign 0.36
R8124:Wdr64 UTSW 1 175799278 splice site probably null
R8129:Wdr64 UTSW 1 175775588 missense probably damaging 0.96
R8673:Wdr64 UTSW 1 175806018 missense probably damaging 1.00
R8728:Wdr64 UTSW 1 175731513 missense probably benign 0.01
R8786:Wdr64 UTSW 1 175808761 nonsense probably null
R8822:Wdr64 UTSW 1 175717354 missense probably damaging 1.00
R8842:Wdr64 UTSW 1 175772327 missense probably benign 0.02
Z1088:Wdr64 UTSW 1 175705985 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GATGCTTTTtgtggcggcgaat -3'
(R):5'- GGCTGTTCTTCTCTATGCTGACATCG -3'

Sequencing Primer
(F):5'- atggcggaggagcagag -3'
(R):5'- CTGtgtatgtttgcatgaatatgtcc -3'
Posted On2014-01-05