Incidental Mutation 'R1124:Ccdc174'
ID95956
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Namecoiled-coil domain containing 174
Synonyms
MMRRC Submission 039197-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1124 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91878053-91899843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91899580 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090] [ENSMUST00000205686]
Predicted Effect probably benign
Transcript: ENSMUST00000037783
AA Change: V466A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: V466A

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Predicted Effect probably benign
Transcript: ENSMUST00000205686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205974
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,082 R642Q possibly damaging Het
9430007A20Rik A G 4: 144,528,624 T205A probably benign Het
Anxa10 C T 8: 62,061,004 probably null Het
Bcl11a A T 11: 24,163,928 M424L probably damaging Het
Bhlhe41 A G 6: 145,863,730 S119P probably damaging Het
C2cd3 A G 7: 100,422,681 D1033G probably benign Het
Drd2 T C 9: 49,395,640 Y9H probably damaging Het
Fbxw14 T A 9: 109,276,168 I310F possibly damaging Het
Gm436 T C 4: 144,670,275 S296G probably benign Het
Gm8298 A G 3: 59,865,218 T48A probably benign Het
Grm3 C T 5: 9,570,297 V316I probably benign Het
Gys2 A G 6: 142,446,013 Y508H probably damaging Het
Lrp1b T A 2: 40,875,051 D2921V probably damaging Het
Lrrc6 T A 15: 66,438,415 T335S possibly damaging Het
Macrod2 A G 2: 140,452,627 K71R probably damaging Het
Myh7 A T 14: 54,973,870 V1614E possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1056 T A 2: 86,355,895 K162N probably damaging Het
Pirb T A 7: 3,719,732 N87I probably benign Het
Pmfbp1 A G 8: 109,530,483 probably null Het
Rasa4 A G 5: 136,105,656 N627S probably benign Het
Spata31d1b A C 13: 59,716,654 M539L probably benign Het
Tbc1d23 A T 16: 57,214,162 probably null Het
Tnfrsf1b A T 4: 145,224,356 L229Q probably benign Het
Trip12 A T 1: 84,737,037 V443E probably damaging Het
Ush2a G T 1: 188,753,536 V2948L probably damaging Het
Vmn1r204 A T 13: 22,557,039 Y280F possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r93 G T 17: 18,298,448 K56N probably benign Het
Xrn1 A G 9: 96,003,865 I880V probably benign Het
Zfp106 C T 2: 120,534,714 G404E probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R0801:Ccdc174 UTSW 6 91895332 missense possibly damaging 0.72
R1237:Ccdc174 UTSW 6 91890787 splice site probably benign
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91899357 missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4775:Ccdc174 UTSW 6 91890894 splice site probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91899366 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGGTCGAAGAAGCAGTCAGAACTC -3'
(R):5'- TCAGCATGGAGAGAAGATAGTCCCC -3'

Sequencing Primer
(F):5'- GAGAACTGCTCCTATGAGTAGCC -3'
(R):5'- TGGAGAGAAGATAGTCCCCCTATAC -3'
Posted On2014-01-05