Incidental Mutation 'R1124:Ccdc174'
ID 95956
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Name coiled-coil domain containing 174
Synonyms C130022K22Rik
MMRRC Submission 039197-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1124 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 91855034-91876824 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91876561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090] [ENSMUST00000205686]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037783
AA Change: V466A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: V466A

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Predicted Effect probably benign
Transcript: ENSMUST00000205686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205974
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,384,039 (GRCm39) R642Q possibly damaging Het
Aadacl2fm3 A G 3: 59,772,639 (GRCm39) T48A probably benign Het
Aadacl4fm1 A G 4: 144,255,194 (GRCm39) T205A probably benign Het
Aadacl4fm4 T C 4: 144,396,845 (GRCm39) S296G probably benign Het
Anxa10 C T 8: 62,514,038 (GRCm39) probably null Het
Bcl11a A T 11: 24,113,928 (GRCm39) M424L probably damaging Het
Bhlhe41 A G 6: 145,809,456 (GRCm39) S119P probably damaging Het
C2cd3 A G 7: 100,071,888 (GRCm39) D1033G probably benign Het
Dnaaf11 T A 15: 66,310,264 (GRCm39) T335S possibly damaging Het
Drd2 T C 9: 49,306,940 (GRCm39) Y9H probably damaging Het
Fbxw14 T A 9: 109,105,236 (GRCm39) I310F possibly damaging Het
Grm3 C T 5: 9,620,297 (GRCm39) V316I probably benign Het
Gys2 A G 6: 142,391,739 (GRCm39) Y508H probably damaging Het
Lrp1b T A 2: 40,765,063 (GRCm39) D2921V probably damaging Het
Macrod2 A G 2: 140,294,547 (GRCm39) K71R probably damaging Het
Myh7 A T 14: 55,211,327 (GRCm39) V1614E possibly damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Or8k23 T A 2: 86,186,239 (GRCm39) K162N probably damaging Het
Pirb T A 7: 3,722,731 (GRCm39) N87I probably benign Het
Pmfbp1 A G 8: 110,257,115 (GRCm39) probably null Het
Rasa4 A G 5: 136,134,510 (GRCm39) N627S probably benign Het
Spata31d1b A C 13: 59,864,468 (GRCm39) M539L probably benign Het
Tbc1d23 A T 16: 57,034,525 (GRCm39) probably null Het
Tnfrsf1b A T 4: 144,950,926 (GRCm39) L229Q probably benign Het
Trip12 A T 1: 84,714,758 (GRCm39) V443E probably damaging Het
Ush2a G T 1: 188,485,733 (GRCm39) V2948L probably damaging Het
Vmn1r204 A T 13: 22,741,209 (GRCm39) Y280F possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Vmn2r93 G T 17: 18,518,710 (GRCm39) K56N probably benign Het
Xrn1 A G 9: 95,885,918 (GRCm39) I880V probably benign Het
Zfp106 C T 2: 120,365,195 (GRCm39) G404E probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91,857,343 (GRCm39) critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91,875,263 (GRCm39) missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91,876,538 (GRCm39) missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91,867,834 (GRCm39) missense probably benign
R0482:Ccdc174 UTSW 6 91,872,247 (GRCm39) missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91,867,873 (GRCm39) splice site probably benign
R0801:Ccdc174 UTSW 6 91,872,313 (GRCm39) missense possibly damaging 0.72
R1237:Ccdc174 UTSW 6 91,867,768 (GRCm39) splice site probably benign
R1388:Ccdc174 UTSW 6 91,858,225 (GRCm39) splice site probably null
R2176:Ccdc174 UTSW 6 91,865,070 (GRCm39) missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91,876,338 (GRCm39) missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91,862,337 (GRCm39) nonsense probably null
R4775:Ccdc174 UTSW 6 91,867,875 (GRCm39) splice site probably null
R4880:Ccdc174 UTSW 6 91,876,572 (GRCm39) unclassified probably benign
R5579:Ccdc174 UTSW 6 91,858,331 (GRCm39) splice site probably null
R5787:Ccdc174 UTSW 6 91,858,291 (GRCm39) nonsense probably null
R5869:Ccdc174 UTSW 6 91,862,399 (GRCm39) utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91,857,272 (GRCm39) missense probably damaging 1.00
R8492:Ccdc174 UTSW 6 91,865,138 (GRCm39) missense probably benign 0.03
RF008:Ccdc174 UTSW 6 91,876,347 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGGTCGAAGAAGCAGTCAGAACTC -3'
(R):5'- TCAGCATGGAGAGAAGATAGTCCCC -3'

Sequencing Primer
(F):5'- GAGAACTGCTCCTATGAGTAGCC -3'
(R):5'- TGGAGAGAAGATAGTCCCCCTATAC -3'
Posted On 2014-01-05