Incidental Mutation 'R1014:Caap1'
ID95979
Institutional Source Beutler Lab
Gene Symbol Caap1
Ensembl Gene ENSMUSG00000028578
Gene Namecaspase activity and apoptosis inhibitor 1
Synonyms
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location94500081-94556796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94549146 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 193 (C193Y)
Ref Sequence ENSEMBL: ENSMUSP00000030313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030313]
Predicted Effect probably benign
Transcript: ENSMUST00000030313
AA Change: C193Y

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030313
Gene: ENSMUSG00000028578
AA Change: C193Y

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 33 58 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
Pfam:CAAP1 113 175 3.2e-31 PFAM
low complexity region 254 271 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
low complexity region 331 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153294
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Caap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Caap1 APN 4 94550430 missense probably damaging 0.98
IGL02542:Caap1 APN 4 94550505 missense probably benign 0.15
IGL03162:Caap1 APN 4 94501024 utr 3 prime probably benign
R0485:Caap1 UTSW 4 94550521 splice site probably null
R1570:Caap1 UTSW 4 94556577 missense probably benign 0.27
R3726:Caap1 UTSW 4 94501143 missense probably damaging 0.99
R4745:Caap1 UTSW 4 94556514 splice site probably null
R4815:Caap1 UTSW 4 94501260 missense probably benign 0.01
R4970:Caap1 UTSW 4 94521060 critical splice donor site probably null
R5143:Caap1 UTSW 4 94501382 missense probably damaging 0.98
R5265:Caap1 UTSW 4 94501228 nonsense probably null
R6513:Caap1 UTSW 4 94501403 missense possibly damaging 0.90
R8936:Caap1 UTSW 4 94501095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCCACTGACAATGGTTCTCAAAA -3'
(R):5'- cacacacacacacGTAAACAACATCAA -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GGCACTTTTTATGTACTGATACAGT -3'
Posted On2014-01-05