Incidental Mutation 'R1014:Gm10300'
ID95985
Institutional Source Beutler Lab
Gene Symbol Gm10300
Ensembl Gene ENSMUSG00000070717
Gene Namepredicted gene 10300
Synonyms
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1014 (G1)
Quality Score130
Status Not validated
Chromosome4
Chromosomal Location132074697-132076992 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 132074712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000094662] [ENSMUST00000105970] [ENSMUST00000105975]
Predicted Effect probably benign
Transcript: ENSMUST00000030739
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094662
AA Change: T6A
SMART Domains Protein: ENSMUSP00000092249
Gene: ENSMUSG00000070717
AA Change: T6A

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105970
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105975
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146021
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Gm10300
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0395:Gm10300 UTSW 4 132074988 intron probably benign
R5809:Gm10300 UTSW 4 132075147 intron probably benign
R6736:Gm10300 UTSW 4 132074935 intron probably benign
R7270:Gm10300 UTSW 4 132074856 missense unknown
Z1176:Gm10300 UTSW 4 132074809 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGCAGCTTGAAGACCAAGACAAC -3'
(R):5'- TTCTGGAGTCACAAAGTCGAGGGG -3'

Sequencing Primer
(F):5'- GACAACTCTTGAGGAAACACAG -3'
(R):5'- ACCTGGAGTCCTGTCGTG -3'
Posted On2014-01-05