Incidental Mutation 'R1014:Slc2a3'
ID96000
Institutional Source Beutler Lab
Gene Symbol Slc2a3
Ensembl Gene ENSMUSG00000003153
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 3
SynonymsGlut-3, Glut3
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122727809-122801640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122731566 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 367 (I367V)
Ref Sequence ENSEMBL: ENSMUSP00000032476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032476] [ENSMUST00000166135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032476
AA Change: I367V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032476
Gene: ENSMUSG00000003153
AA Change: I367V

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 465 5.9e-165 PFAM
Pfam:MFS_1 16 385 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166135
SMART Domains Protein: ENSMUSP00000132586
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 63 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169979
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutations cause embryonic lethality. Heterozygotes for a null allele show partial perinatal lethality and impaired placental transport. Heterozygotes for a gene trap allele show abnormal brain wave patterns, increased startle reflex, reduced prepulse inhibition and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Slc2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Slc2a3 APN 6 122729956 missense probably benign
IGL02056:Slc2a3 APN 6 122735478 missense probably damaging 0.99
IGL02267:Slc2a3 APN 6 122739972 missense probably benign 0.00
IGL02873:Slc2a3 APN 6 122740414 missense probably damaging 0.98
IGL03275:Slc2a3 APN 6 122736742 critical splice acceptor site probably null
R1464:Slc2a3 UTSW 6 122737310 splice site probably benign
R1920:Slc2a3 UTSW 6 122736741 missense probably damaging 0.99
R1990:Slc2a3 UTSW 6 122736735 missense probably damaging 1.00
R3809:Slc2a3 UTSW 6 122732429 missense probably benign 0.03
R4094:Slc2a3 UTSW 6 122735568 missense probably benign 0.23
R4537:Slc2a3 UTSW 6 122737104 missense probably damaging 1.00
R5093:Slc2a3 UTSW 6 122737237 missense probably damaging 0.99
R5186:Slc2a3 UTSW 6 122735583 missense probably damaging 1.00
R5784:Slc2a3 UTSW 6 122735417 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGCTTAGCACAATCATTTCCCCTAAGG -3'
(R):5'- AGACATTGGCTGTGACAGAAATCACTC -3'

Sequencing Primer
(F):5'- CAATCATTTCCCCTAAGGTGAATC -3'
(R):5'- GACAGCAGCTCTGAAAATGG -3'
Posted On2014-01-05