Incidental Mutation 'R1014:Mrgprx2'
ID96003
Institutional Source Beutler Lab
Gene Symbol Mrgprx2
Ensembl Gene ENSMUSG00000074109
Gene NameMAS-related GPR, member X2
SynonymsMrgB10, Mrgprb10
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48478619-48499321 bp(-) (GRCm38)
Type of Mutationsplice site (258 bp from exon)
DNA Base Change (assembly) A to G at 48482558 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098433] [ENSMUST00000186394]
Predicted Effect probably benign
Transcript: ENSMUST00000098433
AA Change: C171R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127022
Gene: ENSMUSG00000074109
AA Change: C171R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 230 4.6e-10 PFAM
Pfam:7tm_1 59 290 1e-6 PFAM
low complexity region 319 334 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186394
SMART Domains Protein: ENSMUSP00000140945
Gene: ENSMUSG00000074109

DomainStartEndE-ValueType
SCOP:d1l9ha_ 11 50 1e-5 SMART
low complexity region 76 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Mrgprx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Mrgprx2 APN 7 48482626 missense probably damaging 1.00
IGL01655:Mrgprx2 APN 7 48482691 nonsense probably null
IGL02052:Mrgprx2 APN 7 48482294 missense possibly damaging 0.75
IGL02254:Mrgprx2 APN 7 48482938 missense probably benign 0.16
IGL02985:Mrgprx2 APN 7 48482497 missense probably damaging 0.98
R0026:Mrgprx2 UTSW 7 48482023 missense possibly damaging 0.66
R0387:Mrgprx2 UTSW 7 48499160 start codon destroyed probably null 0.98
R0514:Mrgprx2 UTSW 7 48482964 start codon destroyed probably null
R0650:Mrgprx2 UTSW 7 48482918 missense probably damaging 0.96
R2011:Mrgprx2 UTSW 7 48482534 missense probably damaging 0.96
R2224:Mrgprx2 UTSW 7 48482860 missense probably benign 0.43
R4238:Mrgprx2 UTSW 7 48482990 missense probably benign
R4846:Mrgprx2 UTSW 7 48482836 missense probably damaging 1.00
R5385:Mrgprx2 UTSW 7 48483005 missense probably benign 0.11
R5891:Mrgprx2 UTSW 7 48482246 missense probably benign
R6490:Mrgprx2 UTSW 7 48482869 missense probably damaging 1.00
R6576:Mrgprx2 UTSW 7 48482632 missense probably damaging 1.00
R6934:Mrgprx2 UTSW 7 48482065 missense possibly damaging 0.79
R6948:Mrgprx2 UTSW 7 48482716 missense possibly damaging 0.52
R7938:Mrgprx2 UTSW 7 48482492 missense probably benign 0.01
R7944:Mrgprx2 UTSW 7 48483005 missense probably benign 0.11
R7945:Mrgprx2 UTSW 7 48483005 missense probably benign 0.11
R8221:Mrgprx2 UTSW 7 48482779 missense probably benign 0.00
R8750:Mrgprx2 UTSW 7 48482030 missense probably benign
R8782:Mrgprx2 UTSW 7 48482551 missense probably damaging 0.98
X0027:Mrgprx2 UTSW 7 48482498 missense probably damaging 1.00
X0063:Mrgprx2 UTSW 7 48482798 missense probably benign 0.04
Z1176:Mrgprx2 UTSW 7 48482342 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGTCTTGCATGGCTCTCTGC -3'
(R):5'- TTGGGCTGGTTGGAAATGCCAC -3'

Sequencing Primer
(F):5'- CCGTTGAAATCGATGATGCC -3'
(R):5'- GTTGGAAATGCCACAGTGC -3'
Posted On2014-01-05