Incidental Mutation 'R1124:Lrrc6'
ID96010
Institutional Source Beutler Lab
Gene Symbol Lrrc6
Ensembl Gene ENSMUSG00000022375
Gene Nameleucine rich repeat containing 6 (testis)
SynonymsLRTP
MMRRC Submission 039197-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1124 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66379858-66500910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66438415 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 335 (T335S)
Ref Sequence ENSEMBL: ENSMUSP00000023006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023006
AA Change: T335S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023006
Gene: ENSMUSG00000022375
AA Change: T335S

DomainStartEndE-ValueType
internal_repeat_1 23 65 8.03e-6 PROSPERO
internal_repeat_1 68 109 8.03e-6 PROSPERO
LRRcap 128 146 2.42e-2 SMART
low complexity region 178 204 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 11 and 22. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,082 R642Q possibly damaging Het
9430007A20Rik A G 4: 144,528,624 T205A probably benign Het
Anxa10 C T 8: 62,061,004 probably null Het
Bcl11a A T 11: 24,163,928 M424L probably damaging Het
Bhlhe41 A G 6: 145,863,730 S119P probably damaging Het
C2cd3 A G 7: 100,422,681 D1033G probably benign Het
Ccdc174 T C 6: 91,899,580 V466A probably benign Het
Drd2 T C 9: 49,395,640 Y9H probably damaging Het
Fbxw14 T A 9: 109,276,168 I310F possibly damaging Het
Gm436 T C 4: 144,670,275 S296G probably benign Het
Gm8298 A G 3: 59,865,218 T48A probably benign Het
Grm3 C T 5: 9,570,297 V316I probably benign Het
Gys2 A G 6: 142,446,013 Y508H probably damaging Het
Lrp1b T A 2: 40,875,051 D2921V probably damaging Het
Macrod2 A G 2: 140,452,627 K71R probably damaging Het
Myh7 A T 14: 54,973,870 V1614E possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1056 T A 2: 86,355,895 K162N probably damaging Het
Pirb T A 7: 3,719,732 N87I probably benign Het
Pmfbp1 A G 8: 109,530,483 probably null Het
Rasa4 A G 5: 136,105,656 N627S probably benign Het
Spata31d1b A C 13: 59,716,654 M539L probably benign Het
Tbc1d23 A T 16: 57,214,162 probably null Het
Tnfrsf1b A T 4: 145,224,356 L229Q probably benign Het
Trip12 A T 1: 84,737,037 V443E probably damaging Het
Ush2a G T 1: 188,753,536 V2948L probably damaging Het
Vmn1r204 A T 13: 22,557,039 Y280F possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r93 G T 17: 18,298,448 K56N probably benign Het
Xrn1 A G 9: 96,003,865 I880V probably benign Het
Zfp106 C T 2: 120,534,714 G404E probably benign Het
Other mutations in Lrrc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Lrrc6 APN 15 66481233 splice site probably benign
IGL01313:Lrrc6 APN 15 66380513 missense probably benign 0.00
IGL01739:Lrrc6 APN 15 66449477 missense probably benign
IGL01863:Lrrc6 APN 15 66396974 splice site probably benign
IGL02074:Lrrc6 APN 15 66489490 missense probably damaging 1.00
IGL02146:Lrrc6 APN 15 66489525 nonsense probably null
IGL02146:Lrrc6 APN 15 66489526 missense probably benign 0.08
IGL03194:Lrrc6 APN 15 66442199 missense probably benign 0.03
droopy UTSW 15 66447676 splice site probably benign
R0087:Lrrc6 UTSW 15 66469975 missense probably benign 0.00
R0178:Lrrc6 UTSW 15 66454101 missense probably benign 0.05
R0463:Lrrc6 UTSW 15 66380474 missense probably benign
R0539:Lrrc6 UTSW 15 66447606 missense probably damaging 0.99
R0608:Lrrc6 UTSW 15 66380474 missense probably benign
R2209:Lrrc6 UTSW 15 66449551 missense probably benign 0.00
R2257:Lrrc6 UTSW 15 66437587 splice site probably benign
R2844:Lrrc6 UTSW 15 66447676 splice site probably benign
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R4281:Lrrc6 UTSW 15 66380529 missense probably benign 0.35
R5163:Lrrc6 UTSW 15 66442218 missense probably benign 0.01
R5636:Lrrc6 UTSW 15 66500816 utr 5 prime probably null
R6365:Lrrc6 UTSW 15 66454134 missense probably benign 0.00
R6567:Lrrc6 UTSW 15 66438379 missense probably benign 0.43
R7751:Lrrc6 UTSW 15 66449563 missense probably benign 0.00
R7774:Lrrc6 UTSW 15 66449552 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAAGGACATGCCCATCAAACAG -3'
(R):5'- GCTAGGGGCAATCAATGCCAAGTG -3'

Sequencing Primer
(F):5'- AAAAACTGGGACCACATGGC -3'
(R):5'- GCTGAAATACTGAATTTCCTCTGGAC -3'
Posted On2014-01-05