Incidental Mutation 'R1124:Tbc1d23'
ID96012
Institutional Source Beutler Lab
Gene Symbol Tbc1d23
Ensembl Gene ENSMUSG00000022749
Gene NameTBC1 domain family, member 23
Synonyms4930451A13Rik, D030022P07Rik
MMRRC Submission 039197-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R1124 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57168862-57231504 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 57214162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023431] [ENSMUST00000226586] [ENSMUST00000228172]
Predicted Effect probably null
Transcript: ENSMUST00000023431
SMART Domains Protein: ENSMUSP00000023431
Gene: ENSMUSG00000022749

DomainStartEndE-ValueType
TBC 41 249 7.22e-5 SMART
RHOD 323 443 7.83e-1 SMART
low complexity region 459 472 N/A INTRINSIC
Blast:TBC 506 630 8e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000226586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227359
Predicted Effect probably benign
Transcript: ENSMUST00000228172
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased serum cytokine production and inflammatory cells in the peritoneum following i.p. lipopolysaccharide injection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,082 R642Q possibly damaging Het
9430007A20Rik A G 4: 144,528,624 T205A probably benign Het
Anxa10 C T 8: 62,061,004 probably null Het
Bcl11a A T 11: 24,163,928 M424L probably damaging Het
Bhlhe41 A G 6: 145,863,730 S119P probably damaging Het
C2cd3 A G 7: 100,422,681 D1033G probably benign Het
Ccdc174 T C 6: 91,899,580 V466A probably benign Het
Drd2 T C 9: 49,395,640 Y9H probably damaging Het
Fbxw14 T A 9: 109,276,168 I310F possibly damaging Het
Gm436 T C 4: 144,670,275 S296G probably benign Het
Gm8298 A G 3: 59,865,218 T48A probably benign Het
Grm3 C T 5: 9,570,297 V316I probably benign Het
Gys2 A G 6: 142,446,013 Y508H probably damaging Het
Lrp1b T A 2: 40,875,051 D2921V probably damaging Het
Lrrc6 T A 15: 66,438,415 T335S possibly damaging Het
Macrod2 A G 2: 140,452,627 K71R probably damaging Het
Myh7 A T 14: 54,973,870 V1614E possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1056 T A 2: 86,355,895 K162N probably damaging Het
Pirb T A 7: 3,719,732 N87I probably benign Het
Pmfbp1 A G 8: 109,530,483 probably null Het
Rasa4 A G 5: 136,105,656 N627S probably benign Het
Spata31d1b A C 13: 59,716,654 M539L probably benign Het
Tnfrsf1b A T 4: 145,224,356 L229Q probably benign Het
Trip12 A T 1: 84,737,037 V443E probably damaging Het
Ush2a G T 1: 188,753,536 V2948L probably damaging Het
Vmn1r204 A T 13: 22,557,039 Y280F possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r93 G T 17: 18,298,448 K56N probably benign Het
Xrn1 A G 9: 96,003,865 I880V probably benign Het
Zfp106 C T 2: 120,534,714 G404E probably benign Het
Other mutations in Tbc1d23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tbc1d23 APN 16 57171776 missense probably damaging 1.00
IGL01063:Tbc1d23 APN 16 57192675 missense probably benign 0.04
IGL01951:Tbc1d23 APN 16 57186685 splice site probably benign
IGL01980:Tbc1d23 APN 16 57189252 splice site probably benign
IGL02457:Tbc1d23 APN 16 57170391 missense probably damaging 1.00
IGL02937:Tbc1d23 APN 16 57184415 missense possibly damaging 0.94
IGL03226:Tbc1d23 APN 16 57214262 missense probably damaging 1.00
R0386:Tbc1d23 UTSW 16 57189273 missense probably damaging 1.00
R0472:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R0479:Tbc1d23 UTSW 16 57171814 missense probably damaging 1.00
R0609:Tbc1d23 UTSW 16 57173106 missense possibly damaging 0.74
R1430:Tbc1d23 UTSW 16 57214210 missense probably damaging 1.00
R1797:Tbc1d23 UTSW 16 57173100 missense possibly damaging 0.90
R1978:Tbc1d23 UTSW 16 57189351 missense probably benign
R4675:Tbc1d23 UTSW 16 57182962 missense possibly damaging 0.72
R4756:Tbc1d23 UTSW 16 57198895 frame shift probably null
R4781:Tbc1d23 UTSW 16 57218415 missense possibly damaging 0.87
R4799:Tbc1d23 UTSW 16 57192628 missense probably benign 0.01
R4895:Tbc1d23 UTSW 16 57198857 critical splice donor site probably null
R5389:Tbc1d23 UTSW 16 57198928 missense probably damaging 1.00
R5601:Tbc1d23 UTSW 16 57198309 missense probably benign 0.02
R6041:Tbc1d23 UTSW 16 57173150 missense probably benign 0.14
R6176:Tbc1d23 UTSW 16 57171789 missense probably damaging 1.00
R6195:Tbc1d23 UTSW 16 57231350 missense possibly damaging 0.56
R6228:Tbc1d23 UTSW 16 57182903 missense probably damaging 0.98
R6232:Tbc1d23 UTSW 16 57170433 missense probably benign 0.39
R6484:Tbc1d23 UTSW 16 57178016 missense probably damaging 1.00
R6670:Tbc1d23 UTSW 16 57214217 missense probably benign 0.00
R6957:Tbc1d23 UTSW 16 57208323 missense probably damaging 1.00
R7218:Tbc1d23 UTSW 16 57170382 missense probably damaging 1.00
R7601:Tbc1d23 UTSW 16 57181534 missense probably benign 0.10
R7877:Tbc1d23 UTSW 16 57173125 missense probably benign 0.35
R7886:Tbc1d23 UTSW 16 57189383 missense possibly damaging 0.95
R8202:Tbc1d23 UTSW 16 57191554 missense probably damaging 1.00
Z1177:Tbc1d23 UTSW 16 57182975 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGTGCCCAGAAGCCATTTAACC -3'
(R):5'- ACATGGTGGTGGGGACACTTGA -3'

Sequencing Primer
(F):5'- CAAGCTCTTCTAATTGAAGGCTGC -3'
(R):5'- GACACTTGATGATGTGTGGATAC -3'
Posted On2014-01-05